We narrowed to 659 results for: pgk promoter
-
Plasmid#228682PurposepPGK1 Promoter for yeast expression with Nterminal tagDepositorInsertpPGK1
ExpressionYeastMutationWTAvailable SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSSa13
Plasmid#177371PurposeExpresses red-shifted luciferase under ScPGK1 promoter in Candida glabrataDepositorInsertCgLUCopt-mut2
PromoterScPGK1pAvailable SinceFeb. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVG122
Plasmid#211765PurposeExpresses strongLOV under PGK1pr. StrongLOV is a variant of optogenetic transcription factor EL222 that is more sensitive than EL222 to blue light.DepositorInsertstrongLOV
UseFor single-copy integration (if cut with pmei)TagsSV40 NLS and VP16ExpressionYeastMutationcompared to EL222, strongLOV contains Glu84Asp mu…Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCEV-G1-Km
Plasmid#46813PurposeTEF1 and PGK1 promoter controlled expression cassettes with G418 resistance for yeast transformationDepositorTypeEmpty backboneTagsFLAG and c-mycExpressionYeastPromoterTEF1 and PGK1Available SinceOct. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCEV-G1-Ph
Plasmid#46814PurposeTEF1 and PGK1 promoter controlled expression cassettes with phleomycin resistance for yeast transformationDepositorTypeEmpty backboneTagsFLAG and c-mycExpressionYeastPromoterTEF1 and PGK1Available SinceDec. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCEV-G2-Km
Plasmid#46815PurposeTEF1 and PGK1 promoter controlled expression cassettes with G418 resistance for yeast transformationDepositorTypeEmpty backboneTagsFLAG and c-mycExpressionYeastPromoterTEF1 and PGK1Available SinceSept. 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCEV-G2-Ph
Plasmid#46816PurposeTEF1 and PGK1 promoter controlled expression cassettes with phleomycin resistance for yeast transformationDepositorTypeEmpty backboneTagsFLAG and c-mycExpressionYeastPromoterTEF1 and PGK1Available SinceSept. 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pILGFP1D5
Plasmid#165063PurposeCharacterisation of yeast promoter using yEGFP as reporter gene and PGK1 terminatorDepositorTypeEmpty backboneExpressionYeastAvailable SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBC001 v3
Plasmid#161711PurposeCMVp-EGFP-[barcode cloning site]-PGKp-Puro-WPREDepositorTypeEmpty backboneUseLentiviral and Synthetic BiologyExpressionMammalianPromoterCMV PromoterAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti.CAG.H2B-cerFP.W.SINloxP
Plasmid#51006PurposeLentivector that expresses H2B-cerFP from internal CAG enhancer-promoterDepositorInsertH2B-cerFP
UseLentiviralTagshistone 2BExpressionMammalianPromoterCAGAvailable SinceJune 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
4xHRE-MinTK-CRE-ODD
Plasmid#141147Purposelentiviral expression vector to generate a hypoxia fate-mapping systemDepositorInsert4xHRE-MinTK-CRE-ODD
UseLentiviralMutationcontains an altered Cre gene modified by the addi…Available SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
iNos-eGFP
Plasmid#207251PurposeReporter for expression of eGFP under control of iNos promoterDepositorAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
cEF1a-GFP
Plasmid#135671PurposeIntroduce constitutive (EF1a promoter) GFP cDNA into (ES) cells by recombination-mediated cassette exchangeDepositorInsertGFP
UseMouse TargetingAvailable SinceMarch 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
cSFFV-GFP
Plasmid#135670PurposeIntroduce constitutive (SFFV promoter) GFP cDNA into (ES) cells by recombination-mediated cassette exchangeDepositorInsertGFP
UseMouse TargetingAvailable SinceMarch 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pILGFP1F5
Plasmid#165064PurposeCharacterisation of TEF1 promoter using yEGFP as reporter gene and PGK1 terminatorDepositorInsertP-URA3>KlURA3>T-AgTEF1-P-TEF1> (BamHI)yEGFP>T-PGK1-T-URA3
ExpressionYeastMutationWTAvailable SinceMarch 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pILGFP1H5
Plasmid#165065PurposeCharacterisation of TEF1 promoter using yEGFP as reporter gene and PGK1 terminator.DepositorInsertP-URA3>KlURA3>T-AgTEF1-P-TEF1>yEGFP>T-PGK1-T-URA3
ExpressionYeastMutationWTAvailable SinceMarch 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
NM9-SpCas9-NLS3
Plasmid#128177PurposeExpresses R. toruloides codon-optimized SpCas9 under PGK1 promoterDepositorInsertSpCas9-NLS3
UseCRISPRExpressionYeastPromoterpPGK1Available SinceApril 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
cTRE-GFP
Plasmid#135665PurposeIntroduce Dox-inducible (TRE promoter) GFP cDNA into (ES) cells by recombination-mediated cassette exchangeDepositorInsertGFP
UseMouse TargetingAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
DR.GFP
Plasmid#17617DepositorAvailable SinceMarch 27, 2008AvailabilityAcademic Institutions and Nonprofits only -
pIALD2HMGr
Plasmid#185867PurposeKnocking out ALD6; expressing acetylating aldehyde dehydrogenase (Lactobacillus reuteri pduP and L. reuteri EutE) and an NADH-preferring HMG-CoA reductase (Delftia acidovorans mvaA) in S. cerevisiaeDepositorInsertALD6(-125, 40)> PSk.GAL1>Da.mvaA>TPGK1-PADH1> Lr.pduP> TPDC1-PGAL2>Lr.EutE-ALD6(1054, 1749)
ExpressionYeastMutationNoneAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
AA043
Plasmid#215964PurposeFragmid fragment: (Pol 2 promoter) human Phosphoglycerate Kinase promoterDepositorHas ServiceCloning Grade DNAInsertPGK_v1
UseFragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
miR-144-451 Trap
Plasmid#61488Purposeto knockdown endogenous miR144 and miR451 levelsDepositorInsertmiR-144-451 Trap
UseLentiviralTagsGFPExpressionMammalianPromoterbidirectional phosphoglycerate kinase promoter (b…Available SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
cEF1a-LSL-GFP
Plasmid#135672PurposeIntroduce Cre-inducible (EF1a promoter followed by lox-stop-lox) GFP cDNA into (ES) cells by recombination-mediated cassette exchangeDepositorInsertGFP
UseMouse TargetingAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2
Plasmid#85208PurposeBackbone for lentiviral gene silencing with monomeric Kusabira-Orange2 expressionDepositorTypeEmpty backboneUseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBT259_(pRosa26-G-tTA2)
Plasmid#36878DepositorInsertsGFP
tTA2
beta-globin intron
Neo
diphteria toxin A
ExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
-
cTRE-GFP-miR30_shRen
Plasmid#135666PurposeIntroduce Dox-inducible (TRE promoter) GFP cDNA plus miR30-embedded shRenilla into (ES) cells by recombination-mediated cassette exchangeDepositorInsertshRenilla
UseMouse TargetingAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
cTRE-GFP-miR30_shPten.1523
Plasmid#135667PurposeIntroduce Dox-inducible (TRE promoter) GFP cDNA plus miR30-embedded shPten into (ES) cells by recombination-mediated cassette exchangeDepositorInsertshPten
UseMouse TargetingAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLIX403_RPS2_APOBEC_HA_P2A_mRuby_Capture1
Plasmid#194703PurposeInducible lentiviral expression, TRE-RPS2-APOBEC-HA-P2A-mRuby; PGK-puro-2A-rtTA (Ribo-STAMP, RPS2)DepositorInsertRPS2 (RPS2 Human)
UseLentiviralTagsAPOBEC1-HA-P2A-mRubyExpressionMammalianPromoterTRE promoter, Tet ONAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-LTR-dCas9-VP64-BFP
Plasmid#46912PurposeHuman expression vector containing MSCV LTR promoter, dCas9 that is fused to 2x NLS, VP64 and tagBFPDepositorInsertsdCas9-VP64-BFP fusion
Puromycin resistance
UseCRISPR and RetroviralTags3xNLS, BFP, and VP64 domainExpressionMammalianPromoterLTR and PGKAvailable SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-LTR-dCas9-p65AD-BFP
Plasmid#46913PurposeHuman expression vector containing MSCV LTR promoter, dCas9 that is fused to 2x NLS, p65 activation domain and tagBFPDepositorInsertsdCas9-p65AD-BFP fusion
Puromycin resistance
UseCRISPR and RetroviralTags2xNLS, BFP, and VP64 domainExpressionMammalianPromoterLTR and PGKAvailable SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
MSCVpuro-6xHis_SUMO2
Plasmid#164938PurposeExpresses 6xHis tagged human Small Ubiquitin Like Modifier 2 (SUMO2) wild type cDNADepositorInsertSmall Ubiquitin Like Modifier 2 (SUMO2 Human)
UseRetroviralTags6XHISPromoterPGK promoterAvailable SinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
EF.GFP
Plasmid#17616DepositorAvailable SinceApril 3, 2008AvailabilityAcademic Institutions and Nonprofits only -
pEM.P03R
Plasmid#198646PurposeEasy-MISE toolkit pEM-plasmid containing PGK1 promoter with FG protruding endsDepositorInsertpPGK1
UseSynthetic BiologyExpressionYeastAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEM.P03L
Plasmid#198645PurposeEasy-MISE toolkit pEM-plasmid containing PGK1 promoter with EF protruding endsDepositorInsertpPGK1
UseSynthetic BiologyExpressionYeastAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pLV[TetOn]-Puro-TRE3G>mNeurog2
Plasmid#198754PurposeVector encodes the gene for murine neurogenin-2 under control of a Tet-controlled promoter and the puromycin resistance gene under control of a constitutive PGK promoterDepositorAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV[TetOn]-Puro-TRE3G>mAscl1
Plasmid#198755PurposeVector encodes the gene for murine Ascl1 under control of a Tet-controlled promoter and the puromycin resistance gene under control of a constitutive PGK promoterDepositorAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBT272_(pRosa26-GTET)
Plasmid#36882DepositorInsertsGFP
tTA2
beta-globin intron
Neo
tdT-3Myc
insulator
diphteria toxin A
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only