-
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEM.P03R
Plasmid#198646PurposeEasy-MISE toolkit pEM-plasmid containing PGK1 promoter with FG protruding endsDepositorInsertpPGK1
UseSynthetic BiologyTagsExpressionYeastMutationPromoterAvailable sinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEM.P03L
Plasmid#198645PurposeEasy-MISE toolkit pEM-plasmid containing PGK1 promoter with EF protruding endsDepositorInsertpPGK1
UseSynthetic BiologyTagsExpressionYeastMutationPromoterAvailable sinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDUAL SRBI (GFP)
Plasmid#86979PurposeLentiviral expression construct encoding SR-B1 and GFP from separate promotersDepositorInsertSCARB1 (SCARB1 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterSFFV/hPGKAvailable sinceFeb. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLIX403_RPS2_APOBEC_HA_P2A_mRuby_Capture1
Plasmid#194703PurposeInducible lentiviral expression, TRE-RPS2-APOBEC-HA-P2A-mRuby; PGK-puro-2A-rtTA (Ribo-STAMP, RPS2)DepositorInsertRPS2 (RPS2 Human)
UseLentiviralTagsAPOBEC1-HA-P2A-mRubyExpressionMammalianMutationPromoterTRE promoter, Tet ONAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-LTR-dCas9-VP64-BFP
Plasmid#46912PurposeHuman expression vector containing MSCV LTR promoter, dCas9 that is fused to 2x NLS, VP64 and tagBFPDepositorInsertsdCas9-VP64-BFP fusion
Puromycin resistance
UseCRISPR and RetroviralTags3xNLS, BFP, and VP64 domainExpressionMammalianMutationPromoterLTR and PGKAvailable sinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-LTR-dCas9-p65AD-BFP
Plasmid#46913PurposeHuman expression vector containing MSCV LTR promoter, dCas9 that is fused to 2x NLS, p65 activation domain and tagBFPDepositorInsertsdCas9-p65AD-BFP fusion
Puromycin resistance
UseCRISPR and RetroviralTags2xNLS, BFP, and VP64 domainExpressionMammalianMutationPromoterLTR and PGKAvailable sinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
MSCVpuro-6xHis_SUMO2
Plasmid#164938PurposeExpresses 6xHis tagged human Small Ubiquitin Like Modifier 2 (SUMO2) wild type cDNADepositorInsertSmall Ubiquitin Like Modifier 2 (SUMO2 Human)
UseRetroviralTags6XHISExpressionMutationPromoterPGK promoterAvailable sinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBT272_(pRosa26-GTET)
Plasmid#36882DepositorInsertsGFP
tTA2
beta-globin intron
Neo
tdT-3Myc
insulator
diphteria toxin A
UseTags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available sinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDUAL CD81 (GFP)
Plasmid#86980PurposeLentiviral expression construct encoding CD81 and GFP from separate promotersDepositorInsertCD81 (CD81 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterSFFV/hPGKAvailable sinceFeb. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDUAL CLDN (GFP)
Plasmid#86981PurposeLentiviral expression construct encoding Claudin-1 and GFP from separate promotersDepositorInsertCLDN1 (CLDN1 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterSFFV/hPGKAvailable sinceFeb. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
cTRE-LSL-GFP-IRES-Cas9-sgCR8
Plasmid#135668PurposeIntroduce Dox/Cre-inducible (TRE promoter followed by lox-stop-lox) Cas9 cDNA plus control-targeting sgRNA into (ES) cells by recombination-mediated cassette exchangeDepositorInsertsgCR8
UseMouse TargetingTagsExpressionMutationPromoterAvailable sinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
cTRE-LSL-GFP-IRES-Cas9-sgPtenX1.1
Plasmid#135669PurposeIntroduce Dox/Cre-inducible (TRE promoter followed by lox-stop-lox) Cas9 cDNA plus Pten-targeting sgRNA into (ES) cells by recombination-mediated cassette exchangeDepositorInsertsgPten
UseMouse TargetingTagsExpressionMutationPromoterAvailable sinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Homo sapiens, Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV[TetOn]-Puro-TRE3G>mAscl1
Plasmid#198755PurposeVector encodes the gene for murine Ascl1 under control of a Tet-controlled promoter and the puromycin resistance gene under control of a constitutive PGK promoterDepositorInsertAscl1 (Ascl1 Mouse)
UseLentiviralTagsExpressionMutationPromoterTRE3GAvailable sinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV[TetOn]-Puro-TRE3G>mNeurog2
Plasmid#198754PurposeVector encodes the gene for murine neurogenin-2 under control of a Tet-controlled promoter and the puromycin resistance gene under control of a constitutive PGK promoterDepositorInsertNeurogenin-2 (Neurog2 Mouse)
UseLentiviralTagsExpressionMutationPromoterTRE3GAvailable sinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJH2972
Plasmid#100956PurposeCas9 driven by PGK1 promoter. gRNA can be cloned into the BplI sites. URA3MX markerDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyTagsExpressionYeastMutationPromoterAvailable sinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJH2970
Plasmid#100954PurposeCas9 driven by PGK1 promoter. gRNA can be cloned into the BplI sites. HIS3MX markerDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyTagsExpressionYeastMutationPromoterAvailable sinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJH2971
Plasmid#100955PurposeCas9 driven by PGK1 promoter. gRNA can be cloned into the BplI sites. KANMX markerDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyTagsExpressionYeastMutationPromoterAvailable sinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
cTRE-PtenWT
Plasmid#135663PurposeIntroduce Dox-inducible (TRE promoter) wildtype Pten cDNA into (ES) cells by recombination-mediated cassette exchangeDepositorInsertPten (Pten Mouse)
UseMouse TargetingTagsExpressionMutationPromoterAvailable sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPL001-BBTK
Plasmid#184751PurposeBig-IN positive control payload encoding EF1a-driven GFP-T2A-BSD. Harbors a backbone counterselectable TK cassette.DepositorInsertpEF1a-eGFP-T2A-BSD-bGHpA
UseCre/Lox, Mouse Targeting, and Synthetic Biology ;…TagsExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
cTRE-PtenC124S
Plasmid#135664PurposeIntroduce Dox-inducible (TREa promoter) C124S-mutant Pten cDNA into (ES) cells by recombination-mediated cassette exchangeDepositorInsertPten (Pten Mouse)
UseMouse TargetingTagsExpressionMutationC124SPromoterAvailable sinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP185 pLVP-dCas9-DNMT3a V2
Plasmid#100936PurposedCas9 and DNMT WT on C terminus, 4 NLS, driven by pGK promoter, with P2A site and PURO gene, within a lentiviral transfer backboneDepositorInsertdCas9, DNMT3a catalytic domain (DNMT3A S.pyogenes, Human)
UseCRISPR and LentiviralTags3xHA and 3xTy1ExpressionMammalianMutationD10A, H840A for dCas9PromoterAvailable sinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCVhyg-HA-FLAG_Ubc9_WT
Plasmid#164936PurposeExpresses FLAG & HA tagged human uman Ubiquitin Conjugating Enzyme 9 (UBC9) wild type cDNADepositorInserthuman UBC9 (UBE2I Human)
UseRetroviralTagsFLAG & HA tagsExpressionMutationPromoterPGK promoterAvailable sinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSCVhyg-HA-FLAG_Ubc9_C93A
Plasmid#164937PurposeExpresses FLAG & HA tagged human Ubiquitin Conjugating Enzyme 9 (UBC9) _C93A mutant cDNADepositorInserthuman UBC9 (UBE2I Human)
UseRetroviralTagsFLAG & HA tagsExpressionMutationPromoterPGK promoterAvailable sinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pimEJ5GFP
Plasmid#44026DepositorInsertEJ5GFP egfp-based chromosomal break reporter
UseTagsExpressionMammalianMutationpCAGGS promoter and eGFP separated by pgkPURO cas…PromoterpCAGGSAvailable sinceMay 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
bRA89
Plasmid#100950PurposeCas9 driven by PGK1 promoter. gRNA can be cloned into the BplI sites. HPH markerDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyTagsExpressionYeastMutationPromoterAvailable sinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
bRA90
Plasmid#100951PurposeCas9 driven by PGK1 promoter. gRNA can be cloned into the BplI sites. LEU2 markerDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyTagsExpressionYeastMutationPromoterAvailable sinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
AZ64_pE.DonorCLYBL.TS
Plasmid#199228PurposeDonor plasmid with CLYBL target sites for ITPN or HMEJ knock-in at the human CLYBL safe harbor locusDepositorInsertExpression unit for EGFP reporter
UseGene targeting donor plasmidTagsExpressionMammalianMutationPromoterHuman PGK1 gene promoterAvailable sinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pILGFP9E3
Plasmid#185842PurposeTesting the TEF1 promoter inserted with 4 TetO elements using a green fluorescence protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1-PTEF1+[TetO]>yEGFP>TPGK1-TURA3
UseTagsExpressionYeastMutationNonePromoterAvailable sinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP4D42
Plasmid#185840PurposeTesting the TEF1 promoter inserted with 4 Z268 elements using a green fluorescence protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1-PTEF1+[Z268]>yEGFP>TPGK1-TURA3
UseTagsExpressionYeastMutationNonePromoterAvailable sinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
AD59_pEP.DonorCLYBL.TS
Plasmid#199227PurposeDonor plasmid with CLYBL target sites for ITPN or HMEJ knock-in at the human CLYBL safe harbor locusDepositorInsertExpression unit for PuroR.T2A.EGFP selectable and reporter markers
UseGene targeting donor plasmidTagsExpressionMammalianMutationPromoterHuman PGK1 gene promoterAvailable sinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pILGFP3A2 (2)
Plasmid#185852PurposeTesting the TEF1 promoter appended with 3 tetracycline riboswitch using a green fluorescence protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1-PTEF1>3*TcRb>yEGFP>TPGK1-TURA3
UseTagsExpressionYeastMutationNonePromoterAvailable sinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP3A2 (1)
Plasmid#185851PurposeTesting the TEF1 promoter appended with 2 tetracycline riboswitch using a green fluorescence protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1-PTEF1>2*TcRb>yEGFP>TPGK1-TURA3
UseTagsExpressionYeastMutationNonePromoterAvailable sinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP4D41
Plasmid#185841PurposeTesting the CYC1 core promoter inserted with 4 Z268 elements using a green fluorescence protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1-PCYC1+[Z268]>yEGFP>TPGK1-TURA3
UseTagsExpressionYeastMutationNonePromoterAvailable sinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
BB44_pmc.DonorR5.TS
Plasmid#199223PurposeDonor plasmid with CCR5 target sites for ITPN or HMEJ knock-in at the human CCR5 safe harbour locusDepositorInsertExpression unit for mCherry - monomeric derivative of DsRed fluorescent protein (Shaner et al., 2004)
UseGene targeting donor plasmidTagsExpressionMammalianMutationPromoterHuman PGK1 gene promoterAvailable sinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only