We narrowed to 13,838 results for: CRISPR-Cas9
-
Plasmid#135338Purpose3xFLAG 2xVP64 SadCas9 for single guide cloningDepositorInsertSadCas9
Tags3xFLAG-VP64-SV40 NLS and NLS-VP64ExpressionMammalianMutationD10A and N580APromoterCMVAvailable SinceMarch 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
Fuw-dCas9-Tet1CD-P2A-BFP
Plasmid#108245PurposeLentiviral vector to express dCas9-Tet1CD-P2A-tagBFPDepositorInsertdCas9-Tet1CD-HA-P2A-BFP
UseLentiviralTagsHAExpressionMammalianMutationdCas9-D10A, dCas9-H840APromoterUbcAvailable SinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
C-Terminal Split Cas9 with GyrA intein
Plasmid#58694PurposeExpresses truncated C-terminal SpCas9 domain fused to a GyrA intein, flanked by ITRs for AAV packaging. Combine with N-Terminal Split Cas9 Gyra Intein for full length SpCas9 productionDepositorInsertHumanized C-Terminal S. pyogenes Cas9 with GyrA Csplit Intein
UseAAV and CRISPRTagsGyrA Csplit Intein and NLSExpressionMammalianPromoterCBhAvailable SinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
Fuw-dCas9-Dnmt3a-P2A-tagBFP
Plasmid#84569PurposeLentiviral construct to express dCas9 fused with Dnmt3a-P2A-tagBFPDepositorAvailable SinceNov. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
LLP457 pGK-dCas9-Suntag-BFP
Plasmid#100957PurposeBPF version of LLP339, Puro is replaced by BFP driven by EF1a, dCas9 with SungTagx10 driven by pGK, with 3xHA tagDepositorInsertdCas9, SunTag array (10xGCN4)
UseCRISPRTags3xHA and BFPExpressionMammalianMutationD10A, H840A for dCas9Available SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSUSL001T:pTRE3G-dCas9-2xKRAB-p2a-tdTomato
Plasmid#209298PurposeA lentiviral vector with tetracycline-inducible system to control expression of S. aureus dCas9 (with tdTomato) to silencing specific genes due to interference with gene transcription machinery.DepositorInsertsdCas9
tdTomato
UseLentiviralExpressionMammalianPromotertetracycline-inducible promoter (TRE3G)Available SinceNov. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAWPSG-Po-nCas9-BE- Ptac-sgRNA(mmoX_1)
Plasmid#195741PurposeBase editing for making a pre-stop codon in mmoX using phenol inducible systemDepositorArticleInsertDi-Methyl Phenol Regulatory protein / APOBEC1-nCas9(D10A)-UGI / Ptac-RiboJ-sgRNA(mmoX_1)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPo (phoenol-inducible promoter)Available SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgTh(2)
Plasmid#209198PurposeMutagenesis of ThDepositorAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-SCGB3A2_gRNA1-SpCas9-T2A-GFP
Plasmid#126698Purposeto express Cas9 from S. pyogenes with 2A-EGFP and sgRNA targeting human SCGB3A2 locus at the end of the endogenous coding sequenceDepositorInsertsgRNA targeting human SCGB3A2 locus
ExpressionMammalianPromoterHuman U6Available SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Hsp1-Hsp2Cas9-KY-P2A-puro
Plasmid#192133PurposeExpresses highly specific Hsp1-Hsp2Cas9, cloning backbone for sgRNA and puromycin resistance geneDepositorInsertHsp1-Hsp2Cas9-KY
UseAAVExpressionMammalianMutationHsp1-Hsp2Cas9 (K390A, Y446A)Available SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAG-DDdCas9VP192-T2A-EGFP-ires-puro
Plasmid#69534PurposeDHFR destabilised domain (DD) fused to dCas9VP192 (S.pyogenes) on CAG expression vector. DDdCas9VP192 protein is stabilised by Trimethoprim.DepositorInsertDD-dCas9VP192-T2A-EGFP
TagsC-term T2A-EGFP and DHFR Destabilised DomainExpressionMammalianPromoterCAGAvailable SinceNov. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRS315e_pGal-dCas9-SH3-pGal-PmCDA1-SHL
Plasmid#79614PurposeExpresses dCas9-SH3 and PmCDA1-SHL in yeast cellsDepositorInsertsSpCas9
PmCDA1
TagsSH3 domain and SHLExpressionYeastMutationD10A and H840A for nuclease deficient Cas9PromoterpGal1 and pGal10Available SinceJuly 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBK2043-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9
Plasmid#223163Purpose2nd gen. AAV backbone for dSaCas9 (endonuclease dead Cas9 from Staphylococcus aureus) and Sa-gRNA ScaffoldDepositorTypeEmpty backboneUseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)Available SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Hsp1-Hsp2Cas9-Y-P2A-puro
Plasmid#192132PurposeExpresses highly specific Hsp1-Hsp2Cas9, cloning backbone for sgRNA and puromycin resistance geneDepositorInsertHsp1-Hsp2Cas9-Y
UseAAVExpressionMammalianMutationHsp1-Hsp2Cas9 (Y446A)Available SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVH333-1-Tier1-PhCMV-dCas9-3xNLS-VP64
Plasmid#169597PurposeTier-1 vector encoding PhCMV-driven dCas9-3xNLS-VP64 expression (PhCMV-dCas9-3xNLS-VP64-pA).DepositorInsertdead S.pyogenes Cas9 - VP64 fusion
ExpressionMammalianPromoterPhCMVAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG>nls-Cas9-nls-2A-Citrine-EcoRI/NotI
Plasmid#169097PurposeCas9 and Citrine expression in transfected cellsDepositorInsertCas9-2A-Citrine
ExpressionMammalianAvailable SinceAug. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRha-ABE8e-SpCas9-NG
Plasmid#201190PurposeExpresses the base editor ABE8e-SpCas9-NG in bacterial cellsDepositorInsertABE8e-SpCas9-NG
Tags8xHIS and BP-NLSExpressionBacterialPromoterpRhaBADAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.SFFV.GFP
Plasmid#57827PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses eGFP via P2A cleavage site. SFFV Promoter drivenDepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV
P2A-eGFP
UseCRISPR and LentiviralTagsFLAGAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only