We narrowed to 12,277 results for: shRNA
-
-
p8266 LentiCRISPR v2 hygro sgNT-1
Plasmid#193977PurposeExpression of spCas9 and non-targeting control sgRNADepositorInsertspCas9
UseLentiviralAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA
Plasmid#215560PurposeConstitutively expressed sgRNA targeting a desired gene (this case pta), ColE1 origin, KanRDepositorInsertgRNA
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119Available SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459_gRNA-ROSA26_hspCas9
Plasmid#193310PurposeCas9 from S. pyogenes and U6 ROSA26 sgRNA (V2.0)DepositorInsertCas9 from S. pyogenes and U6 ROSA26 sgRNA (V2.0)
UseCRISPRExpressionMammalianMutationnot applicableAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pG4
Plasmid#162605PurposeEdit Ade2 gene in yeastDepositorInsertTef1-Cas9 with RPL25 Intron
ExpressionYeastAvailable SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
U6_crRNA_mCherry
Plasmid#197609PurposeExpresses a Cas7-11 crRNA and mCherryDepositorInsertU6_crRNA_mCherry
ExpressionMammalianAvailable SinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
siSlug3
Plasmid#10905DepositorAvailable SinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
pX459_gRNA pAS dual_hspCas9
Plasmid#193312PurposeCas9 from S. pyogenes and U6-pAS dual sgRNA (V2.0)DepositorInsertCas9 from S. pyogenes and U6-pAS dual sgRNA (V2.0)
UseCRISPRExpressionMammalianMutationnot applicableAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pV1200
Plasmid#111429PurposeCaCas9/gRNA Solo entry plasmid for cloning guides - contains stuffer with BsmBI sites - integrates at ENO1 - Recyclable for serial mutagenesis (Sap2-FLP)DepositorInsertCaCas9/sgRNA-BsmBI stuffer
UseCRISPRExpressionYeastAvailable SinceOct. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAVS1_sgRNA
Plasmid#100554PurposeExpresses AAVS1 sgRNA. Target sequence: GGGGCCACTAGGGACAGGATDepositorInsertAAVS1 sgRNA
PromoterU6Available SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
p104_gRNA_Sp_CD3e
Plasmid#213780PurposeExpresses CRISPRi gRNA for CD3e promoter and GFP. gRNA driven by mU6.DepositorInsertSp gRNA
UseCRISPR and LentiviralAvailable SinceMay 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tet-myr-GFP
Plasmid#83468PurposeLentiviral vector for doxycycline-inducible expression of membrane targeted-GFP in mammalian cellsDepositorInsertMyristoylated GFP
UseLentiviralExpressionMammalianPromoterdoxycycline-inducible promoterAvailable SinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBzCas13b-gRNA-1
Plasmid#164858PurposeConstitutive expression of single-spacer CRISPR array with spacer #1 targeting deGFP mRNA for BzCas13b in bacteria.DepositorInsertBzCas13b-gRNA-1
ExpressionBacterialPromoterJ23119Available SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLVPT-rtTR-KRAB
Plasmid#11777PurposeTet-regulated (Tet-off) lentiviral vector for transgene (mPGK promoter) - AND/OR - shRNA (H1 promoter when subcloned from pLVTHM (Addgene#12247)) - 2nd generationDepositorInsertmPGK, GFP, rtTR-KRAB, Tet-off
UseLentiviralExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
siSlug2
Plasmid#10904DepositorAvailable SinceApril 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
pEX128·gRNA
Plasmid#187600PurposeTemplate for amplification of gRNA with Cas6 recognition siteDepositorInsertgRNA template
Promoterno promoterAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCB2-sgRNA
Plasmid#129463PurposeTemplate plasmid for guide sequence insertion via inverse PCR. Derived from pSCrhaB2-gRNA (see paper).DepositorInsertpgRNA
UseCRISPRExpressionBacterialPromoterBBa_J23119 (SpeI)Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
siSlug1
Plasmid#10903DepositorAvailable SinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
GESTALT_pX330-v1
Plasmid#103061Purposeplasmid px330 with guide targeting GESTALT v1 through V5 constructsDepositorInsertintegration of Cas9 with guide targeting GESTALT barcodes V1 to V5
UseLentiviralAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only
