We narrowed to 676 results for: AAV Cas9
-
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA (Backbone) PCB-FlPO-WPRE-syntetisk pA-UTR
Plasmid#68347PurposeAAV plasmid expressing the FlpO recombinase. with empty gRNADepositorInsertFlPO
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV_S34F_U2AF1
Plasmid#176592PurposeAdenoviral construct to change S to F at 34th amino acid (S34F) in human U2AF1DepositorInsertU2AF1 (U2AF1 Human)
UseAAVTagsExpressionMutationPromoterAvailable sinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_K700E_hSF3B1
Plasmid#176591PurposeAdenoviral construct to change K to E at 700th amino acid (K700E) in human SF3B1DepositorInsertSF3B1 (SF3B1 Human)
UseAAVTagsExpressionMutationPromoterAvailable sinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (Hbb Synthetic)
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV_FLAG_hSF3B1
Plasmid#176590PurposeAdenoviral construct to insert a N-terminal FLAG to one allele of human SF3B1DepositorInsertSF3B1 (SF3B1 Human)
UseAAVTagsExpressionMutationPromoterAvailable sinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-TLR6
Plasmid#118997PurposeTargeting vector for human AAVS1 with TLR6 reporter insertDepositorUseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SEP-GluA1 TKIT
Plasmid#169441PurposeExpression of 2 guides + donor DNADepositorInsertSuper ecliptic pHluorin (SEP)
UseAAV and CRISPRTagsExpressionMutationPromoterAvailable sinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SEP-GluA2 TKIT
Plasmid#169442PurposeExpression of 2 guides + donor DNADepositorInsertSuper ecliptic pHluorin (SEP)
UseAAV and CRISPRTagsExpressionMutationPromoterAvailable sinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1_gRNA
Plasmid#196139PurposegRNA targeting the AAVS1 locus in a third generation Cas9 backbone with GFPDepositorInsertAAVS1 gRNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceMarch 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-dSa-VP64-p65(100-261)-RTA(125-190)
Plasmid#99679PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domainsDepositorArticleInsertdCas9
UseAAVTagsVP64-p65(101-261)-RTA(125-190)ExpressionMutationdead Cas9PromoterAvailable sinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SlugABE-NNG
Plasmid#214356PurposeExpresses SlugABE-NNGDepositorInsertSlugABE-NNG
UseAAVTagsExpressionMammalianMutationQ782R/S888R/L906R/N984S/E1012K/K1016IPromoterAvailable sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Puro_siKD
Plasmid#86695PurposeTetracycline inducible expression of shRNA targeted to AAVS1 locusDepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterH1 TOAvailable sinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Puro_siKO
Plasmid#86696PurposeTetracycline inducible expression of guide RNA targeted to AAVS1 locusDepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterH1 TOAvailable sinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Afp
Plasmid#99697PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Afp promoter, vector allows for activation of mouse Afp, can be packaged and delivered as AAVDepositorInsertdCas9 and gRNA targeting Afp (Afp Synthetic)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA-CMV-GFP
Plasmid#85451PurposeExpress sgRNA in mammalian cellsDepositorInsertpCMV-EGFP
UseAAVTagsExpressionMutationPromoterpCMV-EGFPAvailable sinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-tLuc-mCherry
Plasmid#107553PurposetLuc-mCherry in AAV backboneDepositorTypeEmpty backboneUseAAVTagsExpressionMutationPromoterAvailable sinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits only