Skip to main content

We narrowed to 8,159 results for: aav

Showing: 3101 - 3120 of 8159 results
  1. AAV-syn-NES-jGCaMP8m-WPRE

    Plasmid
    #186036
    Purpose
    AAV-mediated cytosolic expression of jGCaMP8m under the synapsin promoter
    Depositor
    Insert
    NES-jGCaMP8m
    Use
    AAV
    Tags
    NES-6xHis
    Expression
    Mammalian
    Promoter
    synapsin
    Available Since
    July 29, 2022
    Availability
    Academic Institutions and Nonprofits only
  2. pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS

    Plasmid
    #117384
    Purpose
    An AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectively
    Depositor
    Insert
    GCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
    Use
    AAV
    Expression
    Mammalian
    Promoter
    CAG
    Available Since
    Oct. 18, 2018
    Availability
    Academic Institutions and Nonprofits only
  3. pAAV-syn-FLEX-axon-jYCaMP1s

    Plasmid
    #135421
    Purpose
    Axon-targeted yellow protein calcium sensor expressed under human Synapsin1 promoter, Cre mediated flip-excision switch, for AAV production or direct transfection, slow variant
    Depositor
    Has Service
    AAV1
    Insert
    jYCaMP1s
    Use
    AAV
    Tags
    GAP43 axon targeting sequence
    Expression
    Mammalian
    Promoter
    hSyn
    Available Since
    Jan. 13, 2020
    Availability
    Academic Institutions and Nonprofits only
  4. AAV-syn-NES-jGCaMP8s-WPRE

    Plasmid
    #186037
    Purpose
    AAV-mediated cytosolic expression of jGCaMP8f under the synapsin promoter
    Depositor
    Insert
    NES-jGCaMP8s
    Use
    AAV
    Tags
    NES-6xHis
    Expression
    Mammalian
    Promoter
    synapsin
    Available Since
    July 29, 2022
    Availability
    Academic Institutions and Nonprofits only
  5. pOTTC533 - pAAV SYN1 eGFP-2A-mKv1.2

    Plasmid
    #75295
    Purpose
    An AAV packaging vector that expresses eGFP and Kv1.2 under the control of a neuronal promoter.
    Depositor
    Insert
    eGFP-2A-mKv1.2 (Kcna2 Mouse, Synthetic)
    Use
    AAV
    Promoter
    human SYN1
    Available Since
    Jan. 22, 2019
    Availability
    Academic Institutions and Nonprofits only
  6. pAAV-HDC-DIO-GFP-shRNA.scramble

    Plasmid
    #184331
    Purpose
    Expresses scramble shRNA for control expts. Flexed (DIO) cassette driven by hdc promoter fragment for pan neuronal expression
    Depositor
    Insert
    hdc pan neuronal gene promoter, flex switch, GFP, scramble shRNA
    Use
    AAV, Cre/Lox, Mouse Targeting, and RNAi
    Expression
    Mammalian
    Promoter
    histidine decarboxylase promoter fragment that g…
    Available Since
    June 27, 2022
    Availability
    Academic Institutions and Nonprofits only
Showing: 3101 - 3120 of 8159 results