We narrowed to 10,362 results for: Coli
-
Plasmid#78576PurposeOver-expression shuttle vector for gene cloning and transfer from E. coli to Streptomyces. Contains strong constitutive ermEp promoterDepositorTypeEmpty backboneUseStreptomyces expressionExpressionBacterialPromoterermEp* promoter from S. erythraeaAvailable SinceApril 26, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pET N6his GFP1-9
Plasmid#182240PurposeTripartite split-GFP. E. coli vector. Expression of GFP1-9 detector fragment.DepositorInsertGFP1-9
Tags6HISExpressionBacterialPromoterT7Available SinceApril 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet1_CylLL_CylM
Plasmid#208759PurposeExpresses modified cytolysin L (mCylLL) in E. coliDepositorInsertsCylLL
CylLM
TagsHisx6 TagExpressionBacterialPromoterT7Available SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pG1AK-mCherry
Plasmid#71737PurposeModular shuttle vector for Geobacillus and E. coliDepositorInsertmCherry
UseSynthetic Biology; Shuttle vectorExpressionBacterialPromoterpRplsWTAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pML433
Plasmid#177190PurposeExpresses recombinant HyPro enzyme in E. coliDepositorInsertHyPro enzyme
ExpressionBacterialPromoterT7Available SinceNov. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-UnaG
Plasmid#203485PurposeFor recombinant protein production in Escherichia coli. His-tagged UnaG under the control of the T7 promoter.DepositorInsertUnaG
ExpressionBacterial and PlantAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T1 mouse PARG (439-959)
Plasmid#132615Purposeexpresses mouse PARG(439-959) in E. coli.DepositorInsertPARG (439-959)
ExpressionBacterialAvailable SinceOct. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZA16mflon
Plasmid#75439PurposePlasmid for arabinose-induced expression of mf-lon. Note that this plasmid contains the original mf-lon cassette that is not codon optimized for expression in E. coli.DepositorInsertmf-lon
ExpressionBacterialPromoterpBADAvailable SinceOct. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJBM4
Plasmid#225291PurposeE. coli-Campylobacter shuttle vector; TetRDepositorInsertTet(O) and its putative promoter
ExpressionBacterialAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSF-T20S
Plasmid#110805Purposeexpresses Thermoplasma acidophilium 20S proteasome in E. ColiDepositorInsertsPsmB
PsmA
Tagstev-HisExpressionBacterialMutationN2D and Q2EPromoterT7 and T7 promoterAvailable SinceJuly 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-J23110-B0034-mRFP1_Yellow
Plasmid#160443PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1_Yellow chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1E_Yellow
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSAP
Plasmid#206429PurposeA vector backbone domesticated for SapI (pCC1BAC-based), contains elements for selection, maintenance, and propagation in S. cerevisiae (TRP1) and E. coli (cat).DepositorTypeEmpty backboneExpressionBacterial and YeastAvailable SinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMOD4 galK-GT
Plasmid#19183DepositorInsertgalK (galK E.coli)
UseRecombineeringTags50 nucleotides from N-term TAP, C-term TAP, and F…Available SinceJan. 29, 2009AvailabilityAcademic Institutions and Nonprofits only -
pALACE
Plasmid#31853DepositorTypeEmpty backboneUseEscherichia coli-mycobacterium shuttle plasmidTags6xHISExpressionBacterialPromoterAcetamidase operoneAvailable SinceJuly 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pND004
Plasmid#200950PurposeMBP-tagged E. coli protein expression destination vector for Golden Gate cloningDepositorTypeEmpty backboneTagsMBPExpressionBacterialPromoterT7Available SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRSF-KpAGO207-1251
Plasmid#117854PurposeExpressed KpAGO 207-1251 in E. coli under IPTG-inducible promotorDepositorInsertArgonaute
Tags6xHis-SUMO encoded in vectorExpressionBacterialMutationmissing first 206 amino acid residuesPromoterT7Available SinceOct. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMulti_S_ccdB
Plasmid#223853PurposeGEC-acceptor for 4G-cloning, designed for expression in E. coli (Streptomycin resistance)DepositorTypeEmpty backboneUseGolden-gate acceptorExpressionBacterialAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pIII/MS2-1
Plasmid#220629PurposeYeast/E. coli shuttle vector in which an RNA polymerase III promoter directs transcription of an RNA containing two tandem MS2 sites.DepositorTypeEmpty backboneExpressionYeastAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
PtxS1-c003
Plasmid#173076PurposeExpression of recombinant fusion protein in E. coliDepositorInsertPtxS1
ExpressionBacterialMutationD35-I221Available SinceNov. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBlueKan+cysMPro
Plasmid#187879PurposeEscherichia coli plasmid containing unique cloning sites behind a Campylobacter jejuni cysM promoter. Cloned genes will be expressed from the constitutively expressed C. jejuni promoter.DepositorTypeEmpty backboneExpressionBacterialPromoterCysMAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMAL-c5X-ELP[V-60]
Plasmid#67013PurposeExpresses malE-ELP[V-60] in E. coliDepositorInsertmalE-ELP[V-60]
TagsHis6 and malE-Factor XaExpressionBacterialPromotertacAvailable SinceJan. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBSV2G_2
Plasmid#118225PurposeEmpty E. coli - B. burgdorferi shuttle vector, gentamicin resistantDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJan. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSG15-pBAD-tetO-deGFP
Plasmid#102450PurposeExpresses deGFP fluorescent protein in E. coli. The expression is controlled by a pBAD-tetO combinatorial promoter.DepositorInsertdeGFP
ExpressionBacterialPromoterpBAD-tetOAvailable SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMAL-c5X-ELP[AV-60]
Plasmid#67012PurposeExpresses malE-ELP[AV-60] in E. coliDepositorInsertmalE-ELP[AV-60]
TagsHis6 and malE-Factor XaExpressionBacterialPromotertacAvailable SinceJan. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-J23110-B0034-mRFP1_Violet
Plasmid#160447PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1_Violet chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1E_Violet
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-J23110-B0034-mRFP1E
Plasmid#160442PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1 chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKFSS1_2
Plasmid#118227PurposeEmpty E. coli - B. burgdorferi shuttle vector; streptomycin resistantDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSG22-pBAD-TetR
Plasmid#102451PurposeExpresses TetR protein in E. coli. The expression is controlled by a pBAD promoter.DepositorAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOGG005
Plasmid#113980PurposeLevel 1 high copy number vector for E. coli expressionDepositorTypeEmpty backboneExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-6xHis-mCherry(-6)
Plasmid#205045PurposeFluorescent protein with charge-patterned cationic peptide to promote biomolecular condensate formation in E. coliDepositorInsertmCherry(-6)
TagsMGHHHHHGGExpressionBacterialAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.26-SS-352
Plasmid#68791PurposeZF9 Op x6 -- GFP-IRES-NTRDepositorInsertsZF9 Op 6x
EGFP
Nitroreductase
TagsIRESExpressionMammalianAvailable SinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28a human Tankyrase2 full length Y920E
Plasmid#132639Purposeexpresses human Tankyrase2 full length Y920E in E. coliDepositorInsertTankyrase2 Y920E
ExpressionBacterialAvailable SinceOct. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUMV19
Plasmid#67161Purposeinducible operation of the mevalonate pathway in E. coliDepositorInsertthe mevalonate pathway genes
ExpressionBacterialPromoterlacZAvailable SinceOct. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSG28-J23151-AraC
Plasmid#102453PurposeExpresses AraC protein in E. coli. The expression is controlled by a constitutive promoter.DepositorAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET22b_pScaC-SNAP_6xHis
Plasmid#228835PurposeE. coli expression of the SNAP-tagged ScaC passenger domainDepositorInsertScaC
TagsSNAPtag-TEV-6xHisExpressionBacterialMutationaa 33-223Available SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet1_CylLS_CylM
Plasmid#208760PurposeExpresses modified cytolysin S (mCylLS) in E. coliDepositorInsertsCylLS
CylLM
TagsHisx6 TagExpressionBacterialPromoterT7Available SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNIC-CFP
Plasmid#173074PurposeExpression vector for E. coli producing target protein with N-terminal CFP fusionDepositorTypeEmpty backboneTagsmCeruleanExpressionBacterialAvailable SinceNov. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBSV2_2
Plasmid#118226PurposeEmpty E. coli - B. burgdorferi shuttle vector; kanamycin resistantDepositorTypeEmpty backboneExpressionBacterialAvailable SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only