We narrowed to 43,183 results for: INA
-
Plasmid#47426DepositorAvailable SinceJuly 29, 2014AvailabilityAcademic Institutions and Nonprofits only
-
myc mTOR kinase dead
Plasmid#8482DepositorAvailable SinceJune 20, 2005AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-pegSERPINA1-U6-Nicking-PE2-N
Plasmid#164907PurposeExpress a pegRNA targeting SERPINA1, and a nicking sgRNA and the N-terminal split-intein fragment of PE2DepositorInsertpegSERPINA1, Nicking sgRNA, PE2-N
UseAAVAvailable SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-1_VNp-mNeongreen-StefinA
Plasmid#182419PurposeBacterial expression of Vesicle Nucleating peptide-mNeongreen-stefinA fusionDepositorInsertVNp-mNeongreen-stefin (CSTA Human)
TagsVesicle Nucleating peptide (VNp) & mNeongreenExpressionBacterialPromoterT7Available SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTXB1.Tat(48-57)-Cre recombinase
Plasmid#165042PurposeExpression of Tat(48-57) conjugated Cre recombinase for protein purification (Intein-chitin binding domain fussion)DepositorInsertCre recombinase
TagsMxe Intein-Chitin binding domain and Tat(48-57)ExpressionBacterialAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-saCBE N-terminal
Plasmid#137182PurposeAAV genome: expresses the N-terminal of S. aureus v5 AAV-CBE from the Cbh promoter, U6-sgRNADepositorInsertv5 AAV-saCBE N-terminal
UseAAVMutationCas9 D10APromoterCbhAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-saCBE_KKH C-terminal
Plasmid#137184PurposeAAV genome: expresses the C-terminal of S. aureus v5 AAV-CBE, and U6-sgRNA (KKH variant).DepositorInsertv5 AAV-saCBE_KKH C-terminal
UseAAVMutationE782K;N968K;R1015H conferring recognition of NNNR…PromoterCbhAvailable SinceJan. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
gRNA3_NIPBL_Cas9-hGem-for_N-terminal_tagging
Plasmid#217662Purposeexpresses Cas9-hGem and guideRNA for N terminal tagging of NIPBLDepositorInsertsgRNA3 for N terminal tagging of NIPBL (NIPBL Human)
UseCRISPRExpressionBacterial and MammalianPromoterU6Available SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
Omega Destination-CMV::ELuc:bGH
Plasmid#124528PurposeOmega destination vector, that has a CMV:ELUC:bgH in the backboneDepositorTypeEmpty backboneUseLuciferase and Synthetic BiologyExpressionMammalianAvailable SinceJune 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-T7-TALEN(Sangamo)-Destination
Plasmid#37184PurposeDestination vector for Voytas Golden Gate TALEN assembly incorporating a CAG promoter for mammalian expression and a T7 promoter for synthesis of TALEN mRNA. Uses homodimeric FokI domains.DepositorTypeEmpty backboneTagsFokI nucleaseExpressionMammalianPromoterCAGAvailable SinceJuly 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-PHLPP1 N-terminal truncation
Plasmid#22404PurposeExpresses a HA tagged, N-terminal truncation of human PHLPP1 in mammalian cellsDepositorAvailable SinceJan. 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
BAS286 C terminal SF-GFP hygBR
Plasmid#74081PurposeS.pombe recoded superfolder GFP in universal C-terminal tagging plasmid, hygB resistancDepositorInsertsuper-folder GFP
Available SinceAug. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-saCBE C-terminal
Plasmid#137183PurposeAAV genome: expresses the C-terminal of S. aureus v5 AAV-CBE from the Cbh promoter, and U6-sgRNADepositorInsertv5 AAV-saCBE C-terminal
UseAAVPromoterCbhAvailable SinceJan. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTarget TMEM97-P2A-mCardinal
Plasmid#157747PurposeExpress in mammalian cells TMEM97 and mCardianl to follow transfection efficiency using flow cytometry. mCardinal is expressed following a P2A skip peptide so it is not connected to TMEM97.DepositorInsertTMEM97 (TMEM97 Human)
ExpressionMammalianAvailable SinceAug. 10, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRW004-SM-destination-proUBQ10-Cas9
Plasmid#104438PurposeDestination vector expressing plant-codon-optimized Cas9 under UBQ10 promoter, with sgRNAs be shuffled in; seed coat specific red fluorescence for screening trangene free plants;DepositorTypeEmpty backboneUseCRISPRExpressionBacterial and PlantPromoterUBQ10Available SinceJan. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-ERBB4 (kinase dead)
Plasmid#29533DepositorAvailable SinceJuly 20, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Bmpr2ΔKinase gRNA resistant
Plasmid#163411PurposeExpresses BMPR-2ΔKinase resistant to the gRNAs(#163388-90) in mammalian cellsDepositorInsertBmpr2 (Bmpr2 Mouse)
ExpressionMammalianMutationThe kinase domain (202-500 aa) is deleted. gRNA-t…Available SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDF1-ERBB4 (kinase dead)
Plasmid#29544DepositorInsertERBB4 (ERBB4 Human)
UseLentiviralExpressionMammalianMutationchanged lysine 751 to methionineAvailable SinceJuly 20, 2011AvailabilityAcademic Institutions and Nonprofits only -
Flag-Rab35 S22N inactive
Plasmid#47429DepositorAvailable SinceJuly 29, 2014AvailabilityAcademic Institutions and Nonprofits only