We narrowed to 8,887 results for: PAN
-
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
INT_Cargo_T7_gfp
Plasmid#212136PurposeCargo plasmid for integrating PT7 expression cassette of green fluorescent protein in genome.Plasmid can be removed by incubating cells at 37 C.DepositorInsertgreen fluorescent protein
ExpressionBacterialPromoterPT7Available SinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
INT_Cargo_T7_CbFDH
Plasmid#212140PurposeCargo plasmid for integrating PT7 expression cassette of formate dehydrogenase in genome. Plasmid can be removed by incubating cells at 37 C.DepositorInsertformate dehydrogenase
ExpressionBacterialPromoterPT7Available SinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA4.1
Plasmid#208306PurposeExpresses ABE-RA4.1 in mammalian cellsDepositorInsertTadA-RA4.1-SpCas9 D10A
ExpressionMammalianMutationP48A, R51H, I76F, A106V, D108G, K110R, T111H, D11…Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA4.3
Plasmid#208308PurposeExpresses ABE-RA4.3 in mammalian cellsDepositorInsertTadA-RA4.3-SpCas9 D10A
ExpressionMammalianMutationP48A, R51H, I76F, A106V, D108G, K110R, T111H, D11…Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA4.4
Plasmid#208309PurposeExpresses ABE-RA4.4in mammalian cellsDepositorInsertTadA-RA4.4-SpCas9 D10A
ExpressionMammalianMutationP48A, R51H, I76F, A106V, D108G, K110R, T111H, D11…Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA4.5
Plasmid#208310PurposeExpresses ABE-RA4.5 in mammalian cellsDepositorInsertTadA-RA4.5-SpCas9 D10A
ExpressionMammalianMutationP48A, R51H, I76F, A106V, D108G, K110R, T111H, D11…Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA4.6
Plasmid#208311PurposeExpresses ABE-RA4.6 in mammalian cellsDepositorInsertTadA-RA4.6-SpCas9 D10A
ExpressionMammalianMutationP48A, R51H, I76F, A106V, D108G, K110R, T111H, D11…Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA5.0
Plasmid#208312PurposeExpresses ABE-RA5.0 in mammalian cellsDepositorInsertTadA-RA5.0-SpCas9 D10A
ExpressionMammalianMutationW23R, H36L, R47K, P48A, R51L, I76F, V82S, A106V, …Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA5.1
Plasmid#208313PurposeExpresses ABE-RA5.1 in mammalian cellsDepositorInsertTadA-RA5.1-SpCas9 D10A
ExpressionMammalianMutationW23R, H36L, R47K, P48A, R51L, I76F, V82S, A106V, …Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA5.3
Plasmid#208314PurposeExpresses ABE-RA5.3 in mammalian cellsDepositorInsertTadA-RA5.3-SpCas9 D10A
ExpressionMammalianMutationW23R, H36L, R47K, P48A, R51L, I76F, V82S, A106V, …Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA5.4
Plasmid#208315PurposeExpresses ABE-RA5.4 in mammalian cellsDepositorInsertTadA-RA5.4-SpCas9 D10A
ExpressionMammalianMutationW23R, R47K, P48A, R51L, I76Y, V82S, A106V, D108G,…Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA5.6
Plasmid#208317PurposeExpresses ABE-RA5.6 in mammalian cellsDepositorInsertTadA-RA5.6-SpCas9 D10A
ExpressionMammalianMutationW23R, H36L, R47K, P48A, R51L, I76Y, V82S, A106V, …Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
FB395
Plasmid#203631PurposeTU for the expression of luciferase under a synthetic promoter containing the target sequence for gRNA1 (1xLuc).DepositorInsertR1:G1aG2b.1:mPAF:Luc:TtrpC
UseSynthetic BiologyAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
FB396
Plasmid#203632PurposeTU for the expression of luciferase under a synthetic promoter containing two copies of the target sequence for gRNA1 (2xLuc).DepositorInsertR1:G1ab.1:mPAF:Luc:TtrpC
UseSynthetic BiologyAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
FB397
Plasmid#203633PurposeTU for the expression of luciferase under a synthetic promoter containing three copies of the target sequence for gRNA1 (3xLuc).DepositorInsertR1:G1abc.3:mPAF:Luc:TtrpC
UseSynthetic BiologyAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMetTU1-A_Sv5K_araC-PBAD_MCD1_AnaA-T6A-L40A_AnaCNJKFGW_Bba-B0015
Plasmid#202024PurposeExpresses Anabaena flos-aquae ARG cluster (GvpA T6A-L40A mutant) in E. coliDepositorInsertAnabaena flos-aquae ARG cluster (GvpA T6A-L40A mutant)
ExpressionBacterialMutationGvpA T6A-L40AAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pACT2-μ4
Plasmid#198176PurposeExpression of GAL4 transcriptional activation domain (AD)-AP-4 μ4 fusion protein in yeast (yeast two-hybrid assays)DepositorInsertAP-4 μ4
TagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastPromoterADH1Available SinceApril 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pACT2-μ2
Plasmid#198173PurposeExpression of GAL4 transcriptional activation domain (AD)-AP-2 μ2 fusion protein in yeast (yeast two-hybrid assays)DepositorInsertAP-2 μ2
TagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastPromoterADH1Available SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgPIGA guide 1
Plasmid#193610PurposePIGA knockoutDepositorInsertsgPIGA guide 1 (PIGA Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only