We narrowed to 20,398 results for: otos
-
Plasmid#197100PurposeTo express the variant of Methanosarcina mazei PylRS specific for pyrrolysine derivatives (Boc-Lys, Az-ZLys, AzAmZLys) and its cognate Pyl tRNA and allow UAG codon to be translated into these derivatiDepositorInsertPylRS variant, Pyl tRNA, kanamycin resistance gene
ExpressionBacterialMutationLys61, Glu131, Ala306, Phe384, Glu444 (PylRS)Available SinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
opto-E-cad GFP
Plasmid#203327PurposeExpresses E-cadherin with a LOV2 insert after T133 for blue light inhibition in mammalian cellsDepositorInsertPhotoswitchable - E-cadherin with GFP tag (CDH1 Human)
TagsGFPExpressionMammalianMutationAddition of Aslov2 domain at T133 of human E-cadh…Available SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBabe-TetCMV-puro-mCherry-PA-Rac1
Plasmid#22035PurposeExpression of photoactivatable Rac1DepositorInsertmCherry-PA-Rac1 (RAC1 Avena sativa (oat), Human)
UseRetroviralExpressionMammalianMutationRac1 starts at I4 and contains mutations Q61L, E9…PromoterTet-CMVAvailable SinceSept. 11, 2009AvailabilityAcademic Institutions and Nonprofits only -
pEB1N-LZ-LOV2(wt)
Plasmid#107614PurposeN-terminal half of π-EB1 with wild-type LOV2, no fluorescent tagDepositorInsertMAPRE1 (MAPRE1 Human)
TagsA. sativa phototropin 1 LOV2 domain and GCN4 leuc…ExpressionMammalianMutationEB1 aa 1-185; resistant to EB1 shRNA#3 (Addgene #…PromoterCMVAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTriEx-mCherry-PA-Rac1-T17N
Plasmid#22029PurposeExpression of photoactivatable Rac1 (dominant-negative mutant).DepositorInsertPA-Rac1-T17N (RAC1 Avena sativa (oat), Human)
Tags6xHis and mCherryExpressionBacterial, Insect, and Mamm…MutationLOV(Leu404-Leu546). Rac1 starts at Ile4 and conta…PromoterCMV, p10Available SinceSept. 29, 2009AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-imp α
Plasmid#119718PurposeExpresses EGFP-tagged human importinα in mammalian cellsDepositorInsertimportinα (KPNA2 Human)
TagsEGFPExpressionMammalianMutationcontains amino acids 251-529PromoterCMVAvailable SinceSept. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTriEx-mCerulean-PA-Rac1
Plasmid#22030PurposeExpression of photoactivatable Rac1DepositorInsertPA-Rac1 (RAC1 Avena sativa (oat), Human)
Tags6X His and mCeruleanExpressionBacterial, Insect, and Mamm…MutationRac1 starts at I4 and contains mutations Q61L, E9…PromoterCMV, p10Available SinceSept. 29, 2009AvailabilityAcademic Institutions and Nonprofits only -
Tom20-mChF-AIP
Plasmid#61512PurposeExpression of human FK506 binding protein 1A (FKBP1A) tagged with mCherry, Tom20, and AIPDepositorInsertFK506 binding protein 1A (FKBP1A Human)
TagsAIP, Tom20, and mCherryExpressionMammalianPromoterCMVAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEB1N-LZ-mCherry-LOV2(wt)
Plasmid#107693PurposeN-terminal half of π-EB1 with wild-type LOV2, mCherry-tagged to track microtubule endsDepositorInsertMAPRE1 (MAPRE1 Human)
TagsA. sativa phototropin 1 LOV2 domain, GCN4 leucine…ExpressionMammalianMutationEB1 aa 1-185; resistant to EB1 shRNA#3 (Addgene #…PromoterCMVAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-PPO-mScarlet
Plasmid#139503PurposeExpresses mScarlet-tagged parapinopsin in mammalian cells for photoswitchable control of inhibitory GPCR signaling cascades.DepositorInsertparapinopsin
TagsmScarlet following Gly-Gly-Ser linkerExpressionMammalianPromoterCMVAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
mCh-KIF13A*-strep
Plasmid#120166PurposeExpresses a chimera of mCherry (fluorescent tag), a KIF13A-based anterograde motor and streptavidinDepositorInsertkinesin family member 13A (KIF13A Human)
TagsStreptavidin and mCherryExpressionMammalianMutationTruncated KIF13A: 1-639 aaPromoterCMVAvailable SinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
mCh-KIF17*-strep
Plasmid#120167PurposeExpresses a chimera of mCherry (fluorescent tag), a KIF17-based anterograde motor and streptavidinDepositorInsertkinesin family member 17 (KIF17 Human)
TagsStreptavidin and mCherryExpressionMammalianMutationTruncated KIF17: 1-509 aaPromoterCMVAvailable SinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEB1N-LZ-LOV2(fast)
Plasmid#107690PurposeN-terminal half of π-EB1 with fast LOV2, no fluorescent tagDepositorInsertMAPRE1 (MAPRE1 Human)
TagsA. sativa phototropin 1 LOV2 domain (I427V, H519L…ExpressionMammalianMutationEB1 aa 1-185; resistant to EB1 shRNA#3 (Addgene #…PromoterCMVAvailable SinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTriEx-mPA-GFP-PA-Rac1
Plasmid#22022PurposeExpression of photoactivatable Rac1DepositorInsertPA-Rac1 (RAC1 Avena sativa (oat), Human)
Tags6X His and mPA-GFPExpressionBacterial, Insect, and Mamm…MutationRac1 starts at I4 and contains mutations Q61L, E9…PromoterCMV, p10Available SinceSept. 29, 2009AvailabilityAcademic Institutions and Nonprofits only -
pTriEx-mVenus-PA-Rac1-T17N
Plasmid#22017PurposeExpression of photoactivatable Rac1 (dominant-negative mutant)DepositorInsertPA-Rac1-T17N (RAC1 Avena sativa (oat), Human)
Tags6X His and mVenusExpressionBacterial, Insect, and Mamm…MutationRac1 starts at I4 and contains mutation T17N.PromoterCMV, p10Available SinceSept. 29, 2009AvailabilityAcademic Institutions and Nonprofits only -
LentiV_Neo_Sik3_T142Q
Plasmid#119973PurposeLentiviral expression plasmid of mouse Sik3 cDNA (gatekeeper mutation) with neomycin resistance geneDepositorInsertSik3 (Sik3 Mouse)
UseLentiviralExpressionMammalianMutationchange Threonine 142 to GlutaminePromoterEFS promoterAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
p5E-MCS-c-Fos-b-globin (JDW 1237)
Plasmid#229829PurposeA gateway compatible 5' entry clone containing an MCS upstream of the murine c-fos minimal promotor and b-globin intron.DepositorInsertc-fos minimal promoter and b-globin intron
UseGateway CloningExpressionMammalianAvailable SinceFeb. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCALNL-mutKir2.1
Plasmid#125579PurposeCre-dependent expression of a non-conducting mutant of Kir2.1 (FLAG-tagged) in mammalian cells.DepositorInsertKir2.1 (Kcnj2 Mouse)
UseCre/LoxTagsFLAGExpressionMammalianMutationA non-conducting mutant (GYG -> AAA).Available SinceJuly 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pmKO-imp α
Plasmid#200082PurposeExpresses mKO-tagged human importinα in mammalian cellsDepositorAvailable SinceJune 21, 2023AvailabilityAcademic Institutions and Nonprofits only