We narrowed to 9,450 results for: tre promoter
-
Plasmid#120467PurposeBarcoded lentiviral vector to express NEUROG1 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-EF1a-double floxed-Aldh1a1-HA-WPRE-HGHpA
Plasmid#184633PurposeExpresses Aldh1a1 fused to HA, driven by the Ef1a promoter, in a Cre-dependent fashionDepositorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-30a(+)-Syk-tSH2-PM
Plasmid#111271Purposeexpress murine Syk tandem SH2 domains (Ser 8 to Gln 264), with Y130E mutation to mimic phosphorylation, in E.coli strain Rosetta 2 (DE3)DepositorInsertmurine Syk tandem SH2 domains (Ser 8 to Gln 264), with Y130E mutation to mimic phosphorylation (Syk Mouse)
ExpressionBacterialMutationY130E mutation to mimic phosphorylationPromoterT7 promoterAvailable SinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFastBac HT JS-Munc18b
Plasmid#135554PurposeExpress rat Munc18b in Sf9 cells, the resulted plasmid encodes an N-terminally His6-tagged Munc18c protein with a tobacco etch virus (TEV) cleavage site between the His6 tag and Munc18b.DepositorInsertMunc18b (Stxbp2 Rat)
Tags6xHis tag and TEV siteExpressionInsectPromoterpolyhedrin promoterAvailable SinceMarch 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
cARA12-mRFP
Plasmid#181961PurposeARA12 protein tagged with mRFP, under control of TBA2 promoterDepositorAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJL3
Plasmid#184131PurposeFor rescuing null mrp-1 mutation and labelling mrp-1 protein. Intestinal specific Pges-1 promoter drives MRP-1 expression. Translational fusion construct. pPD95.75_Pges-1::mrp-1(isoform C cDNA)::gfp.DepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
RCAN1-aa1-150
Plasmid#65412PurposeRCAN1 aa1-150 expression with CMV promoter. Flag tagged.DepositorInsertRCAN1-aa1-150 (Rcan1 Mouse)
TagsFlagExpressionMammalianMutationaa1-150 present, deleted 151 to endAvailable SinceJune 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
CAG-mRuby2(miRE.FF4)-TS.FF6x1-bGH
Plasmid#235297PurposeComMAND open-loop circuit regulating mRuby2, CAG-drivenDepositorInsertmRuby2
UseSynthetic BiologyExpressionMammalianPromoterCAG (synthetic cytomegalovirus early enhancer + c…Available SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAG-mRuby2(miRE.FF4)-TS.FF4x1-bGH
Plasmid#235298PurposeComMAND closed-loop circuit regulating mRuby2, CAG-drivenDepositorInsertmRuby2
UseSynthetic BiologyExpressionMammalianPromoterCAG (synthetic cytomegalovirus early enhancer + c…Available SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAG-mRuby2-bGH
Plasmid#235296PurposeComMAND base gene regulating mRuby2, CAG-drivenDepositorInsertmRuby2
UseSynthetic BiologyExpressionMammalianPromoterCAG (synthetic cytomegalovirus early enhancer + c…Available SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pro::EX1-2(intΔNACs&ΔMYBs):GFP
Plasmid#218572PurposeTranscriptional reporter for ARF7 promoterDepositorInsertAT5G20730 (NPH4 Mustard Weed)
ExpressionPlantMutationMutation genomic sequence 85nt, 86nt from TA to C…Available SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFsynW SYT1-PGM reporter
Plasmid#197278PurposeEncodes for viral expression of Synaptotagmin 1 (SYT1) for use in the RUSH system; visualized with HaloTag. Reporter only (no hook). SYT1 is mutated to disrupt palmitoylation and glycosylation.DepositorInsertSYT1 and HaloTag (Syt1 Rat)
UseLentiviralTagsFLAGMutationT15A, T16A, N24Q, C74A, C75A, C77A, C79A, and C82APromoterhSyn (human synapsin I promoter)Available SinceJuly 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRB133.2
Plasmid#181950PurposeaTc-inducible expression of PhoP with C-terminal mNeonGreen fusion. Also contains mCherry under PhoP-controlled promoter PvirKDepositorInsertPhoP-Salmonella enterica subsp. enterica serovar Typhimurium (AX04_RS23485 Synthetic, PhoP-Salmonella enterica subsp. enterica serovar Typhimurium)
TagsmNeonGreenExpressionBacterialPromoterPhoP-mNG-PLtetO-1; mCherry-PvirK; tetR-J23106Available SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBABR Bcd-LEXY
Plasmid#182594PurposeDrosophila integration plasmid expressing Bcd-LEXY fusion protein under the maternal tubulin promoter.DepositorAvailable SinceAug. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBS-V7
Plasmid#173796PurposepBS plasmid containing aadA gene with 16S rRNA promoter and psbA 3’ region, Silene latifolia clpP1 gene with the tobacco regulatory elements and flanking regions for tobacco plastome transformationDepositorInsertsaadA
ClpP1
ExpressionBacterial and PlantAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBS-V6
Plasmid#173795PurposepBS plasmid containing aadA gene with 16S rRNA promoter and psbA 3’ region, Silene conica clpP1 gene with the tobacco regulatory elements and flanking regions for tobacco plastome transformationDepositorInsertsaadA
ClpP1
ExpressionBacterial and PlantAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBS-V4
Plasmid#173794PurposepBS plasmid containing aadA gene with 16S rRNA promoter and psbA 3’ region, Nicotiana tabacum clpP1 gene with native regulatory elements and flanking regions for tobacco plastome transformationDepositorInsertsaadA
ClpP1
ExpressionBacterial and PlantAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPN455
Plasmid#137872PurposeExpression of gRNA targeting POGZ for CRISPRa; U6 promoterDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN447
Plasmid#137871PurposeExpression of gRNA targeting POGZ for CRISPRi; U6 promoterDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Laccase2 MCS-Laccase2 608-1097
Plasmid#69890PurposeExpresses the Drosophila laccase2 exon 2 circular RNADepositorInsertLaccase2 (stw Fly)
ExpressionInsectMutationL158I in laccase2PromoterMetallothionein Promoter (pMT)Available SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6-mir451 EF1Alpha-puro-T2A-BFP
Plasmid#164792PurposeExpress miR-451 under the U6 promoter in mammalian cellsDepositorInsertsUseLentiviralExpressionMammalianPromoterEF1Alpha and U6Available SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS SARS-CoV-2 XBB Spike
Plasmid#195287PurposeExpresses codon-optimized full length SARS-CoV-2 XBB SpikeDepositorInsertSARS-CoV-2 XBB Spike (S )
ExpressionMammalianMutationContains the following mutations: T19I, LPPA24-27…Promoterchicken β-actin promoter, CMV enhancerAvailable SinceFeb. 8, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLC-Flag-UBE2G1 sg2R-P2A-Hygro
Plasmid#124299PurposeLentiviral vector for expression of Flag tagged UBE2G1-P2A-Hygro casette from a CMV promoter. UBE2G1 cDNA contains silent mutations to disrupt a sgRNA binding site.DepositorInsertUBE2G1 (UBE2G1 Human)
UseLentiviralTagsFlagExpressionMammalianMutationseveral silent mutations to disrupt sgRNA targeti…PromoterCMVAvailable SinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLC-Flag-SENP8 sg2R-P2A-Hygro
Plasmid#124300PurposeLentiviral vector for expression of Flag tagged SENP8-P2A-Hygro casette from a CMV promoter. SENP8 cDNA contains silent mutations to disrupt a sgRNA binding site.DepositorInsertSENP8 (SENP8 Human)
UseLentiviralTagsFlagExpressionMammalianMutationseveral silent mutations to disrupt sgRNA targeti…PromoterCMVAvailable SinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTFG005_Spike_Inducible_3xFlag
Plasmid#191578PurposeInducible expression of SARS-CoV-2 Spike protein with C-terminal 3x FLAG tag under TRE3G promoter and cloned into a 2nd generation lentiviral transfer plasmid (modified pLVX with Hygro resistance).DepositorInsertSARS-CoV-2 Spike Protein (S Synthetic)
UseLentiviralTags3x FLAGExpressionMammalianPromoterTRE3GAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-EGFP
Plasmid#166140PurposeEGFP expression under the control of the Galactose-inducible promoter yeast. Contains CEN/ARS element for low copy within yeast.DepositorInsertEGFP
ExpressionYeastPromoterGAL1Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
proE-cad178-Luc-mEbox
Plasmid#42082DepositorInsertE-cadherin (CDH1 Human)
UseLuciferaseExpressionMammalianMutationcontains E-cadherin promoter region from -178 to …PromoterE-cadherinAvailable SinceFeb. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAG426GAL-EGFP
Plasmid#166143PurposeEGFP expression under the control of the Galactose-inducible promoter in yeast. Contains 2 um element for high copy within yeast.DepositorInsertEGFP
ExpressionYeastPromoterGAL1Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG426GAL-mRuby3
Plasmid#166144PurposemRuby3 expression under the control of the Galactose-inducible promoter in yeast. Contains 2 um element for high copy within yeast.DepositorInsertmRuby3
ExpressionYeastPromoterGAL1Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
proE-cad670-Luc-mEbox
Plasmid#42084DepositorInsertE-cadherin (CDH1 Human)
UseLuciferaseExpressionMammalianMutationcontains E-cadherin promoter region from -670 to …PromoterE-cadherinAvailable SinceApril 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-mRuby3
Plasmid#166141PurposemRuby3 expression under the control of the Galactose-inducible promoter yeast. Contains CEN/ARS element for low copy within yeast.DepositorInsertmRuby3
ExpressionYeastPromoterGAL1Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (mPCSK9)
Plasmid#170122PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse PCSK9 mRNA, expressed from human and mouse U6 promotersDepositorInsertCircular 200,100 guide RNA (Pcsk9 Mouse)
UseAAVExpressionMammalianPromoterHuman U6 and mouse U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
p36-p37-p38-p40-pET-Duet-1
Plasmid#175049PurposeOverexpression of human Rfc2,Rfc3,Rfc4,Rfc5 in E.coliDepositorExpressionBacterialPromoterT7 promoterAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAW-Nb127D01-GFP
Plasmid#171571PurposeExpresses GFP-tagged anti-CXCR2 (human) recombinant llama nanobody (Nb127D01-GFP) in fly cellsDepositorAvailable SinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAW-Nb127D01-mCherry
Plasmid#171573PurposeExpresses mCherry-tagged anti-CXCR2 (human) recombinant llama nanobody (Nb127D01-mCherry) in fly cellsDepositorAvailable SinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBI121::chitGFP5:AQ
Plasmid#240450PurposeExpression of indicator protein fusion (soluble modified GFP5 & Aequorin) for monitoring calcium concentrations in cell walls of higher plants. See Resource Information.DepositorInsertFusion of Chitinase signal, smGFP5, and Aequorin
ExpressionBacterial and PlantMutationGFP5 for expression plants (PMID 9122158); Solubl…PromoterCauliflower mosaic virus 35S promoter (GenBank AJ…Available SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBI121::smEclipGFP:AQ
Plasmid#240454PurposeExpression of indicator protein fusion (soluble modified ecliptic pHluorin & Aequorin) for monitoring calcium concentrations and pH in the cytoplasm of higher plants. See Resource Information.DepositorInsertFusion of soluble modified ecliptic pHluorin and Aequorin
ExpressionBacterial and PlantMutationEcliptic GFP (ecliptic pHluorin) (PMID 9671304); …PromoterCauliflower mosaic virus 35S promoter (GenBank AJ…Available SinceSept. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAW-CD8-Nb127D01-GFP
Plasmid#171577PurposeExpresses GFP-tagged anti-CXCR2 (human) recombinant llama nanobody (Nb127D01-GFP) in fly cell cytomembraneDepositorInsertCD8-Nb127D01-GFP (CXCR2 Human)
TagsCD8 and GFPExpressionInsectPromoterfly actin5C promoterAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only