We narrowed to 28,582 results for: RAN-1
-
Plasmid#204350PurposeExpresses wild-type PDGFRb gene. Used for DNA delivery using Adeno-associated Virus.DepositorAvailable SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only
-
-
pChlr-1SE
Plasmid#52140PurposeEncodes module 1 with amino acids 12S-16E for recognition of nt 8GDepositorInsertPumilio homology domain amino acids 25-60 (PUM1 Human)
ExpressionBacterialMutationChanged 16Q to 16E in Module 1Available SinceApril 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGEX-mTAZ-WW (86)
Plasmid#40915DepositorInsertTAZ (Wwtr1 Mouse)
TagsGSTExpressionBacterialMutationContains mTAZ 14-3-3 binding site and WW domain (…PromoterTacAvailable SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
p176 Dync1i2.B (Ex1b)
Plasmid#26444DepositorInsertcytoplasmic dynein 1 intermediate chain 2 isoform B (exon 1b) (Dync1i2 Mouse)
UseSubcloning and sequencingMutationN/AAvailable SinceMarch 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
p177 Dync1i2.C (Ex 1b)
Plasmid#26445DepositorInsertcytoplasmic dynein 1 intermediate chain 2 isoform C (exon 1b) (Dync1i2 Mouse)
UseSubcloning and sequencingMutationN/AAvailable SinceMarch 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
p197 Dync1i2.B (Ex1a)
Plasmid#26447DepositorInsertcytoplasmic dynein 1 intermediate chain 2 isoform B (exon 1a) (Dync1i2 Mouse)
UseSubcloning and sequencingMutationN/AAvailable SinceMarch 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
TFORF2967
Plasmid#144443PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceSept. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2826
Plasmid#143631PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2824
Plasmid#143630PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2827
Plasmid#143632PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1972 - [1-2] ENTR - Flour - TagBFP2(NLS(2), no_atg, no_stop)
Plasmid#159844PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Flour - TagBFP2(NLS(2), no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFd029.R2.RFP
Plasmid#137972PurposeExpresses Prochlorococcus marinus NATL1A Fd 1 fused to mRFPDepositorInsertProchlorococcus marinus NATL1A ferredoxin 1 fused to monomeric RFP
UseSynthetic BiologyAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFd030.R2.RFP
Plasmid#137973PurposeExpresses Prochlorococcus marinus NATL2A Fd 1 fused to mRFPDepositorInsertProchlorococcus marinus NATL2A ferredoxin 1 fused to monomeric RFP
UseSynthetic BiologyAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFd031.RFP
Plasmid#137974PurposeExpresses Prochlorococcus marinus MIT9211 Fd 1 fused to mRFPDepositorInsertProchlorococcus marinus MIT9211 ferredoxin 1 fused to monomeric RFP
UseSynthetic BiologyAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-CMV-GFP-shNts1
Plasmid#132713PurposeEncodes short hairpin RNA (shRNA) #1 that targets the the 3’-untranslated region of the rat Nts geneDepositorAvailable SinceOct. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
AtPIN2
Plasmid#117089Purposeprotein expression in yeastDepositorInsertAtPIN2
TagsHisExpressionYeastPromoterAOXAvailable SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
tdTomato-Cx32-7
Plasmid#58085PurposeLocalization: Gap Junctions, Excitation: 554, Emission: 581DepositorAvailable SinceDec. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
mKO-Cx32-7
Plasmid#57835PurposeLocalization: Gap Junctions, Excitation: 548, Emission: 561DepositorAvailable SinceOct. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
mKO2-Cx32-7
Plasmid#57866PurposeLocalization: Gap Junctions, Excitation: 551, Emission: 565DepositorAvailable SinceOct. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
mKOet-Cx32-7
Plasmid#57915PurposeLocalization: Gap Junctions, Excitation: 548, Emission: 561DepositorAvailable SinceOct. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
Rabbit NHERF-1
Plasmid#31644DepositorInsertsolute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1 (SLC9A3R1 Rabbit)
ExpressionBacterialMutationnoneAvailable SinceFeb. 14, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-tagBFP-hTRF2
Plasmid#103803PurposeBLInCR 'Localizer' construct that marks the telomeres and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorExpressionMammalianMutationhTRF2: deletion of amino acids 1-42 and 476 compa…PromoterCMVAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLENTICRISPR V2 sgTMEM173_1
Plasmid#241456PurposeDelete TMEM173 (STING)DepositorAvailable SinceMarch 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAG8Ha-His-PPIL1
Plasmid#237554PurposeE. coli recombinant protein expressionDepositorInsertPeptidyl-prolyl cis-trans isomerase-like 1 (PPIL1 Human)
Tags8xHis - TEV cleavage siteExpressionBacterialPromoterT7Available SinceFeb. 3, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSA096 PSMD4_IVS6-Cas9-BFP
Plasmid#249146PurposeOverexpression of SpCas9-BFP with PSMD4 IVS6 intron in 5' UTR and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertPSMD4_IVS6-Cas9-TagBFP (PSMD4 S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationPSMD4 IVS6 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAIP4_5YPV
Plasmid#234150PurposeHeterologous protein expression of malonyl CoA-acyl carrier protein transacylase in Escherichia coliDepositorInsert5YPV
Tags10x HisTag-Smt3ExpressionBacterialPromoterT7Available SinceMarch 6, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
TFORF1828
Plasmid#142861PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-myc-STIM1-WPRE-UbC-Emerald
Plasmid#225939PurposeLentiviral vector plasmid expressing human stromal interaction molecule 1 (STIM1) fused to myc-tag under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianPromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
SFFV-NR2F2-Brd 331
Plasmid#219261PurposeTranscription factor NR2F2 with a specific barcode assigned.DepositorAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
SFFV-RBCK1-Brd 233
Plasmid#219176PurposeTranscription factor RBCK1 with a specific barcode assigned.DepositorAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGAL4-DBD-HOXD4-AroPLUS_PATCHED
Plasmid#215584PurposeFor overexpression of Gal4-DBD HOXD4 AroPLUS PATCHEDDepositorInsertHOXD4 AroPLUS PATCHED (HOXD4 Human)
ExpressionMammalianAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX458-SPNS1-sg1
Plasmid#198566PurposeSPNS1-targeting sgRNA in PX458 vectorDepositorAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGAL4-DBD-HOXD4-AroPERFECT_YPWM_(+)
Plasmid#215581PurposeFor overexpression of Gal4-DBD HOXD4 AroPERFECT YPWM(+)DepositorInsertHOXD4 AroPERFECT YPWM(+) (HOXD4 Human)
ExpressionMammalianAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGAL4-DBD-HOXD4-AroLITE_G
Plasmid#215573PurposeFor overexpression of Gal4-DBD HOXD4 AroLITE GDepositorInsertHOXD4 AroLITE G (HOXD4 Human)
ExpressionMammalianAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGAL4-DBD-HOXD4-AroPERFECT_shuffled2
Plasmid#215578PurposeFor overexpression of Gal4-DBD HOXD4 AroPERFECT shuffled 2DepositorInsertHOXD4 AroPERFECT shuffled2 (HOXD4 Human)
ExpressionMammalianAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGAL4-DBD-HOXD4-AroLITE_S
Plasmid#215572PurposeFor overexpression of Gal4-DBD HOXD4 AroLITE SDepositorInsertHOXD4 AroLITE S (HOXD4 Human)
ExpressionMammalianAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGAL4-DBD-HOXD4_WT(N)-FUSNxs
Plasmid#215630PurposeFor overexpression of Gal4-DBD HOXD4 WT(N) FUSNxsDepositorInsertHOXD4(N) FUSNxs (HOXD4 Human)
ExpressionMammalianAvailable SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGAL4-DBD-HOXD4-AroPERFECT-2
Plasmid#215576PurposeFor overexpression of Gal4-DBD HOXD4 AroPERFECT-2DepositorInsertHOXD4 AroPERFECT-2 (HOXD4 Human)
ExpressionMammalianAvailable SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGAL4-DBD-HOXD4-AroPERFECT_shuffled1
Plasmid#215577PurposeFor overexpression of Gal4-DBD HOXD4 AroPERFECT shuffled 1DepositorInsertHOXD4 AroPERFECT shuffled1 (HOXD4 Human)
ExpressionMammalianAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGAL4-DBD-HOXD4-AroLITE_YPWM_(+)
Plasmid#215580PurposeFor overexpression of Gal4-DBD HOXD4 AroLITE YPWM(+)DepositorInsertHOXD4 AroLITE YPWM(+) (HOXD4 Human)
ExpressionMammalianAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGAL4-DBD-HOXD4-AroPLUS_LITE
Plasmid#215583PurposeFor overexpression of Gal4-DBD HOXD4 AroPLUS LITEDepositorInsertHOXD4 AroPLUS LITE (HOXD4 Human)
ExpressionMammalianAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
EDC3
Plasmid#155561PurposeFor use in RBP tethering screenDepositorAvailable SinceSept. 6, 2023AvailabilityAcademic Institutions and Nonprofits only