We narrowed to 6,076 results for: cat.2
-
Plasmid#73717PurposeC. elegans germline CRE expression vectorDepositorInsert2xNLS-CRE
UseCre/LoxExpressionWormPromoterPeft-3Available SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-Nsp13-HF_GC3opt
Plasmid#157716Purposemammalian expression of C-terminally His8-Flag tagged SARS-CoV-2 Nsp13 under control of a tetracycline-inducible promoterDepositorInsertNsp13-HF_GC3opt (ORF1ab SARS-CoV-2)
TagsHis8-FlagExpressionMammalianMutationcodon optimized; gene expression was optimized by…Available SinceAug. 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA5-FRT-TO-FH-Nsp13
Plasmid#157713Purposemammalian expression of N-terminally Flag-His8 tagged SARS-CoV-2 Nsp13 under control of a tetracycline-inducible promoterDepositorAvailable SinceAug. 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-syn-iGluSnFR4s-NGR-WPRE (AAV1)
Viral Prep#234437-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-syn-iGluSnFR4s-NGR-WPRE (#234437). In addition to the viral particles, you will also receive purified pAAV-syn-iGluSnFR4s-NGR-WPRE plasmid DNA. Syn-driven, iGluSnFR4s-NGR sensor expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-iGluSnFR4f-NGR-WPRE (AAV1)
Viral Prep#234438-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-syn-iGluSnFR4f-NGR-WPRE (#234438). In addition to the viral particles, you will also receive purified pAAV-syn-iGluSnFR4f-NGR-WPRE plasmid DNA. Syn-driven, iGluSnFR4f-NGR sensor expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
P1
Plasmid#87089PurposeThis is the P1 part of the Bcl-2 promoter with a luciferase reporter in pGL3Basic plasmidDepositorTypeEmpty backboneExpressionMammalianPromoterBcl-2 PromoterAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBP-T7_RBS-His6-Thrombin
Plasmid#72979PurposeT7 promoter, RBS, His6-tag and thrombin cleave site - derived from pET15b (5' CTAT/3' CATA) fusion)DepositorInsertT7+RBS+His6+thrombin
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDH-METTL14-WT
Plasmid#141112PurposeOverexpression of WT METTL14 in mammalian cells.DepositorInsertHMETTL14 (METTL14 Human)
ExpressionMammalianAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-mSTING
Plasmid#214156PurposeTransient expression of STINGDepositorAvailable SinceMarch 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-hSTING (R232)
Plasmid#214152PurposeTransient expression of STING R232DepositorAvailable SinceMarch 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGT-Ah7
Plasmid#122574PurposeMAGIC donor plasmid (Himar transposon with catP/sfGFP payload)DepositorInsertcatP/sfGFP
UseSynthetic BiologyExpressionBacterialAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pETM33_Nsp4
Plasmid#156474PurposeBacterial expression of Sars-CoV2 Nsp4 protein with His-tag and GST-tagDepositorInsertNsp4 (ORF1ab Severe acute respiratory syndrome coronavirus 2, Synthetic)
TagsHis-GSTExpressionBacterialMutationGene insert is codon optimized for Ecoli.PromoterT7/LacOAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
Yellow Cameleon-Nano30/pcDNA3
Plasmid#51963Purposemammalian expression of Yellow Cameleon-Nano30, an ultrasensitive Ca2+ indicator with Kd = 30 nMDepositorInsertYellow Cameleon-Nano30
ExpressionMammalianAvailable SinceMarch 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
p15aC-3D1D-5
Plasmid#121050PurposeBacterial expression of PIS, PI4K and PI3P5K mutant E545KDepositorInsertsPIS
phosphatidylinositol 4-phosphate 5-kinase
phosphatidylinositol 3-kinase catalytic subunit p110α of class IA E545K
Tagsmyc and noneExpressionBacterialAvailable SinceApril 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTwist-WIV1-CoV Δ18
Plasmid#164439PurposeEncodes WIV1-CoV Spike Protein lacking 18 C-terminal amino acids for pseudovirus productionDepositorInsertWIV1-CoV Spike truncated to remove 18 amino acids
ExpressionMammalianAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGS-CD64-2
Plasmid#109191PurposeEncodes full-length engineered CD64 with C-terminal Twin-Strep tag to be expressed in a baculovirus/insect cell expression systemDepositorInsertFull-length engineered CD64, derived from human CD64
TagsTwin-StrepExpressionInsectMutationengineered for efficient expression, see publicat…PromoterPolyhedrinAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX458_KDM1A_2
Plasmid#86298PurposeEncodes gRNA for 3' target of human KDM1ADepositorInsertgRNA against KDM1A (KDM1A Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
shCDK4/6(2)
Plasmid#73555Purposevector encoding both shRNA against CDK4(2) and shRNA against CDK6(2)DepositorInsertshRNA against CDK4 + shRNA against CDK6
UseRetroviralExpressionMammalianPromoterLTRAvailable SinceAug. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.2/V5-DEST SNAP29-V5
Plasmid#69821PurposeExpresses SNAP29-V5 in mammalian cellsDepositorInsertSynaptosomal-associated protein 29 (SNAP29 Human)
UseRetroviralTagsV5ExpressionMammalianPromotercmvAvailable SinceApril 26, 2016AvailabilityAcademic Institutions and Nonprofits only