We narrowed to 12,047 results for: shRNA
-
Plasmid#220901PurposeMobileCRiSPRi test system encoded on a kanR Tn7 transposon; mScarlet-I, PD-sgRNA (mscar targeting), and PC-dCas9-novoDepositorInsertdCas9-novo
UseCRISPRTags3xMycExpressionBacterialMutationD10A, H840AAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pISFba1reRNA
Plasmid#226822PurposeExpressing ISFba1 guide RNA targeting maeB site controled by PJ23119DepositorInsertISFba1 none target guide RNA
ExpressionBacterialAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEE393
Plasmid#149283PurposeT-DNA encoding TRV2 with Truncated FT augmented gRNA targeting NbPDS3DepositorInsertp35S:TRV2_NbPDS3sgRNA_TrunFT:tNos
ExpressionPlantPromoter35SAvailable SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCas34
Plasmid#82386PurposesgRNA targeting YFP expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX459-sgRNA048_Grb10
Plasmid#232934PurposeExpression vector for a sgRNA against the mouse Grb10 locus and SpCas9 with T2A-Puromycin resistance gene.DepositorInsertCas9-T2A-PuroR (Grb10 S. pyogenes)
ExpressionMammalianAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJMP8930
Plasmid#220905PurposeMobileCRiSPRi system encoded on a kanR Tn7 transposon; PD-sgRNA (BsaI site) and PC-dCas9-novo (for cloning new guides)DepositorInsertdCas9-novo
UseCRISPRTags3xMycExpressionBacterialMutationD10A, H840AAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-OCT4
Plasmid#69537PurposeEpisomal plasmid encoding 5 gRNAS targeting human OCT4 promoterDepositorInsert5 concatenated gRNA transcriptional cassettes targeting OCT4
UseCRISPRAvailable SinceDec. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
p426-SNR52p-gRNA.csr-1.Y-SUP4t
Plasmid#68060PurposegRNA for csr-1 locus in N. crassaDepositorInsertgRNA for csr-1 locus
UseCRISPR; N. crassa, fungiExpressionYeastPromoterSNR52Available SinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-Puro-shPP2A-Aalpha
Plasmid#15249DepositorInsertPP2A regulatory subunit A, alpha isoform (PPP2R1A Human)
UseRNAi and RetroviralExpressionMammalianAvailable SinceJuly 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pDGE6
Plasmid#79476PurposesgRNA shuttle vector; module 1EDepositorInsertpAtU6-ccdB-sgRNA (ccdB(letD) )
UseCRISPR and Synthetic BiologyMutationBsaI site eliminatedAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
LentiUniversal-Puro
Plasmid#127749PurposeLentiviral plasmid for expressing any U6 driven transcripts (sgRNAs, crRNAs, shRNAs and etc...)DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterhuman U6Available SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAC-crRNA-Km
Plasmid#158712PurposePlasmids containing the medium-copy-number p15A origin of replication can be propagated in E. coli cells and a non-targeting crRNADepositorInsertAcGFP (for crRNA cloning)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterTetOAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEM-sgMUC1_dual-MTS-3x-Set I
Plasmid#162763PurposeSeparately expressing 3 unique sgMUC1_dual-MTS (SetI)DepositorInsertsgMUC1_dual-MTS_1; sgMUC1_dual-MTS_2; sgMUC1_dual-MTS_3
ExpressionMammalianPromoterU6Available SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S_P0526-sgRNAmreB
Plasmid#149654Purposeall-in-one CRISPRi vector for targeting B. burgdorferi mreBDepositorInsertdCas9, lacI, sgRNAmreB
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30, P0526Available SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nucGFP11-3xControlgRNA
Plasmid#224568PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), three Control gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)MutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_ctrA
Plasmid#133339Purposefor constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets ctrA gene's promoter from Caulobacter crescentusDepositorInsertsgRNA_ctrA
UseCRISPRPromoterconstitutiveAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJ23119-sgRNA
Plasmid#113654PurposesgRNA targeting unit plasmid. The sgRNA targeting unit plasmids contain connector ConLS, ConR1, and one sgRNA transcriptional unit.DepositorInsertpromoter J23119 and sgRNA
UseCRISPRExpressionBacterialPromoterJ23119Available SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXPR_212
Plasmid#133457PurposeU6 promoter expresses customizable Spyo-guide; EFS promoter expresses SaurCas9 and 2A site provides puromycin resistanceDepositorInsertcontrol guide
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGLucIPZ
Plasmid#228703PurposeConstitutive expression of Gaussia luciferase, puromycin N-acetyl-transferase and shRNAmir of interestDepositorInsertsGaussia luciferase
non-silencing shRNA
UseLentiviralExpressionMammalianAvailable SinceDec. 2, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits