We narrowed to 28,295 results for: grna
-
Plasmid#131473PurposeEndogenous tagging of Tarpγ8: Intramolecular (amino acid position: V376)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA and GFP donor (Cacng8 Rat)
ExpressionMammalianPromoterU6 and CbhAvailable sinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SMVP-Cas9N-U6-gRNA TdL
Plasmid#80938PurposeExpresses Cas9N in mammalian cells; expresses gRNA TdL for Ai9 cleavage.DepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable sinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYLsgRNA-OsU6c
Plasmid#66197Purposecloning of sgRNAs for expression in plantsDepositorTypeEmpty backboneUseCloning vectorPromoterOsU6cAvailable sinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pUC19-U6-BsmBI_cassette-Nme/Nme2Cas9-sgRNA (KAC32)
Plasmid#133794PurposeU6 promoter sgRNA entry vector used for all NmeCas9 or Nme2Cas9 sgRNAs (clone spacer oligos into BsmBI cassette) - similar to sgRNA architecture from Amrani et al. Genome Biology 2018DepositorInsertNmeCas9 and Nme2Cas9 sgRNA entry vector
ExpressionMammalianMutationsgRNA architecture from Amrani et al. Genome Biol…PromoterU6Available sinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVMG0303_Cq-U6-6_2xBbsI_gRNA-Loop
Plasmid#169370PurposeExpression of gRNA in Culex quinquefasciatus or other mosquitoesDepositorInsertpVMG0303_Cq-U6-6_2xBbsI_gRNA-Loop
UseCRISPRExpressionInsectPromoterCPIJ039596Available sinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_RNF138_G1
Plasmid#127120DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA RNF138 (RNF138 Human)
UseCRISPRAvailable sinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGGDestTol2LC-3sgRNA
Plasmid#64241Purposedestination vector for three U6x:sgRNA cassettesDepositorTypeEmpty backboneUseCRISPRAvailable sinceMay 5, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGGDestTol2LC-2sgRNA
Plasmid#64240Purposedestination vector for two U6x:sgRNA cassettesDepositorTypeEmpty backboneUseCRISPRAvailable sinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PX458_KLF11_1
Plasmid#86314PurposeEncodes gRNA for 3' target of human KLF11DepositorPublicationInsertgRNA against KLF11 (KLF11 Human)
UseCRISPRAvailable sinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KLF11_2
Plasmid#86315PurposeEncodes gRNA for 3' target of human KLF11DepositorPublicationInsertgRNA against KLF11 (KLF11 Human)
UseCRISPRAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pVMG0303_Cq-U6-6_2xBbsI_gRNA-Loop
Plasmid#169370PurposeExpression of gRNA in Culex quinquefasciatus or other mosquitoesDepositorInsertpVMG0303_Cq-U6-6_2xBbsI_gRNA-Loop
UseCRISPRExpressionInsectPromoterCPIJ039596Available sinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_RNF138_G1
Plasmid#127120DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA RNF138 (RNF138 Human)
UseCRISPRAvailable sinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
Zebrafish-gRNA-0008
Plasmid#42248PurposegRNA targeted to zebrafish gene tia1lDepositorAvailable sinceJan. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-BRD4-HaloTag-Guide-hspCas9
Plasmid#228576PurposeExpression of Halo-tagged human BRD4 gRNA; CRISPR-mediated gene insertionDepositorAvailable sinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Pzac2.1 U6-control sgRNA1, 2, 3_gfaABC1D mcherry SV40
Plasmid#179120PurposeExpresses control sgRNAs under the U6 promoter and mcherry protein specifically in astrocytesDepositorInsertcontrol sgRNA
UseAAVPromoterU6Available sinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSico_U6-PLOD2 sgRNA4
Plasmid#136459PurposeExpression of gRNA against human PLOD2DepositorInsertgRNA against human PLOD2 (PLOD2 Human, Synthetic)
UseCRISPR and LentiviralExpressionMammalianAvailable sinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
PX458_ZGPAT_2
Plasmid#86328PurposeEncodes gRNA for 3' target of human ZGPATDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against ZGPAT (ZGPAT Human)
UseCRISPRAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only