We narrowed to 6,022 results for: crispr cas9 expression plasmids
-
Plasmid#129534PurposeAAV vector expressing Nme2Cas9DepositorInserthuman codon-optimized Nme2Cas9
UseAAVTags2xNLS and NLS-3xHA-NLSPromoterU1aAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_VPR_KanR neo
Plasmid#167893PurposePiggyBac compatible plasmid expressing Cas9-VPRDepositorInsertCas9-VPR
UseCRISPRAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-J23111
Plasmid#113149PurposePlasmid constitutively expressing dCas9 proteinDepositorInsertdCas9
ExpressionBacterialMutationD10A & H840AAvailable SinceJan. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLM-AMA18.0 dCas9-VPR
Plasmid#138945PurposeFungal AMA1 backbone plasmid with sp-dCas9 fused to VP64-p65-Rta (VPR); ribozymes based sgRNA transcription unit; Terbinafine and Phleomycin selection markersDepositorInsertp40S:sp_dCas9m4_2xNLS-VPR; HH-HDV sgRNA transcription unit, Terbinafine (ergA) and Phleomycin (ble) selection markers
UseCRISPR and Synthetic Biology; Ama1 autonomously r…TagsNLSPromoterp40S (AN0465) Aspergillus nidulansAvailable SinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_NoFlag_hROSA26_Left
Plasmid#191442PurposeExpresses the hROSA26 left sgRNA in combination with FLAGless eSpCas9(1.1) to target the hRosa26 safe harbor locusDepositorInserthROSA26 sgRNA
UseCRISPRExpressionMammalianPromoterCBhAvailable SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-Z3-Kan
Plasmid#232096PurposeYeast CEN plasmid for estradiol-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertZ3 promoter and Z3EV transcription factor
UseCRISPRExpressionYeastPromoterZ3Available SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
SETD2(SET)-Cas9
Plasmid#186700PurposePlasmid encoding SETD2-Cas9 fusion under CMV promoterDepositorInsertSETD2(SET)-Cas9
UseCRISPRTagsFLAGExpressionMammalianPromoterCMVAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
SIN-cPPT-G1B3-spCas9-WPRE-miR124T
Plasmid#245071PurposeCRISPR Editing with SpCas9, with miRNA-124 target sequence to repress transgene expression in neuronsDepositorInsertCas9, miR124T site
UseLentiviralExpressionMammalianPromoterHuman G1B3 promoterAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiV_Cas9_puro
Plasmid#108100PurposeLentiviral expression plasmid of spCas9 with puromycin resistance geneDepositorInsertCas9
UseCRISPR and LentiviralTagsFLAGExpressionMammalianPromoterEFS promoterAvailable SinceJuly 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-NED
Plasmid#109358PurposeMammalian vector for expressing effector domains fused to dCas9.DepositorTypeEmpty backboneUseCRISPRTagsdCas9, SV40 NLS, 3xFLAGExpressionMammalianPromoterCMVAvailable SinceMay 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSMVP-Cas9FL-P2A-turboGFP
Plasmid#80941PurposePlasmid that expresses Cas9FL in mammalian cells; co-expresses turboGFP.DepositorInsertCas9FL
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSMVP-Cas9C-P2A-turboGFP
Plasmid#80935PurposePlasmid that expresses Cas9C in mammalian cells; co-expresses turboGFP.DepositorInsertCas9C
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
1255_pAAV-U6-SA-BbsI-MluI-gRNA-CB-SACas9-HA-OLLAS-spA
Plasmid#109320PurposePlasmid for AAV SaCas9 Mammalian Expression with a BbsI cloning site for a gRNADepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceJune 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDD162 (Peft-3::Cas9 + Empty sgRNA)
Plasmid#47549PurposeCas9 + sgRNA plasmid that can be modified to cleave any Cas9 target site in the C. elegans genome.DepositorInsertsCas9
Empty sgRNA
UseCRISPRTagsHA and NLSExpressionWormMutationCodon optimized and with synthetic introns for C.…PromoterU6 and eef-1A.1 (eft-3)Available SinceSept. 9, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHiFi Cas9-2×sgRNA (empty, donor)
Plasmid#162277PurposeAll-in-one vector for CRISPR/Cas9-mediated homology-independent knock-in system. The plasmid contains BPNLS-HiFi Cas9-BPNLS and two sgRNA expression cassettes.DepositorInsertHiFi Cas9
UseCRISPRTagsBPNLS and FLAG tagExpressionMammalianMutationSpCas9 (R691A)Available SinceAug. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1alpha-dCas9-10xGCN4_Hygro
Plasmid#192651Purpose3rd generation lenti vector encoding dCas9-10xGCN4 (Suntag) with 2A Hygro resistance markerDepositorInsertdCas9-10xGCN4
UseCRISPR and LentiviralExpressionMammalianMutationD10A and N863A in Cas9PromoterEF1aAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-SYN-NLS-SaCas9-NLS-3xHA-bGHpA-U6-BsaI-sgRNA
Plasmid#218710PurposeAAV vector plasmid expressing Cas9 from Staphylococcus aureus (SaCas9) under the human synapsin (SYN) promoter and its sgRNA under the U6 promoterDepositorInsertshSaCas9
Chimeric guide for SaCas9
UseAAV and CRISPRTags3xHA and NLSExpressionMammalianAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJUMP18-dCas9_O
Plasmid#127028PurposeBasic Part O- ORF; Catalytically dead mutant of the Cas9 from Streptococcus pyogenes.DepositorInsertPart dCas9_O
UseSynthetic BiologyExpressionBacterialMutationNoneAvailable SinceJuly 1, 2019AvailabilityAcademic Institutions and Nonprofits only