We narrowed to 9,089 results for: sgRNA
-
Plasmid#209782PurposeExpresses SaCas9 by the specific cTNT promoter and sgRNA targeted the mouse Camk2d gene by U6 promoterDepositorInsertsgRNA
UseAAVTagsHA and OLLASPromotercTNTAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
M-SP-sgRNA
Plasmid#48671PurposeMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBluescriptSKII+ U6-sgRNA(F+E) ACTB
Plasmid#74705PurposeEncodes an sgRNA for spCas9 driven by hU6 promoter with a modified scaffold (Chen et al. Cell 2013) and a spacer targeting the 3'UTR of ACTB mRNADepositorInsertU6 promoter driving sgRNA targeting the 3'UTR of ACTB mRNA
UseCRISPRExpressionMammalianAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
U6-AsCas12f-sgRNA-v2
Plasmid#204639PurposeExpression of trancated AsCas12f sgRNA in mammalian cellsDepositorInserttrancated AsCas12f sgRNA (sgRNA-v2)
ExpressionMammalianPromoterU6Available SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEJS654 All-in-One AAV-sgRNA-hNmeCas9
Plasmid#112139PurposeDelivery of human-codon-optimized Cas9 from Neisseria meningitidis (NmeCas9) and its single-guide RNA in a single AAV vector for in vivo genome editing.DepositorInsertssgRNA scaffold
Human-codon-optimized NmeCas9
UseAAV, CRISPR, and Mouse TargetingExpressionMammalianPromoterU1a and U6Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA-Adra1b
Plasmid#184293PurposeA single vector containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA targeting Adra1bDepositorInsertssgRNA-Adra1b
sgRNA-Adra1b
UseAAV and CRISPRExpressionMammalianAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti SpBsmBI sgRNA Puro
Plasmid#62207PurposeAn empty sgRNA expression vector for expression of sgRNA for Sp Cas9 (3rd generation lentiviral vector)DepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterU6Available SinceMay 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSmart-Nm-sgRNA-BbsI
Plasmid#49157PurposePlasmid for cloning spacer into sgRNA for NmCas9DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
CRISPRainbow Kit for Multiplex Labeling
Plasmid Kit#1000000079PurposePlasmids using dCas9 and gRNA scaffolds that bind fluorescent proteins to label multiple chromosomal loci.DepositorApplicationGenome EditingVector TypeLentiviral, Mammalian ExpressionEditing TypeCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
CaTCH Dual-sgRNA_sgBC1-A_sgBC1-C
Plasmid#154196PurposeLentiviral expression plasmid encoding two sgRNAs for targeting of the CaTCH barcode cassette BC1. Expresses Thy1.1 and a Neo selection marker.DepositorInsertsgRNA-BC1-A, sgRNA-BC1-C
UseLentiviral; Catch barcode activationExpressionMammalianPromoterhU6 and mU6Available SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-sgRNA-Target1 (MpRTN1)
Plasmid#186291PurposeGateway entry vector for sgRNA (target 1: MpRTN1). Transient expression of sgRNA (Target 1: MpRTN1) for MpRTN1 in plant cellsDepositorInsertsgRNA-Target1
UseCRISPRAvailable SinceNov. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJR107
Plasmid#187245PurposeLentiviral sgRNA vector for CROP-seq with mU6 sgRNA promoter, CR1 constant region, and UCOE EF1alpha driving PURO-GFP marker expressionDepositorInsertLentiviral sgRNA vector for CROP-seq with mU6 sgRNA promoter
UseLentiviralAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJR106
Plasmid#187244PurposeLentiviral sgRNA vector for CROP-seq with mU6 sgRNA promoter, CR1 constant region, and UCOE EF1alpha driving PURO-BFP marker expressionDepositorInsertLentiviral sgRNA vector for CROP-seq with mU6 sgRNA promoter
UseLentiviralAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
psgRNA
Plasmid#114005Purposeexpress sgRNA. ColE1, KanDepositorInsertgRNA
PromoterBBa_J23119Available SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHEE401
Plasmid#71286PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistanceDepositorInsertssgRNA scaffold
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 promoter and U6-26p Arabidopsis U6 gene pro…Available SinceJan. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEM-2t
Plasmid#159752PurposeCRISPR/Cas9 genome editing in plants; a template for PCR-derived fragments used in the assembly of polycistronic transcripts, where sgRNAs are separated by an Arabidopsis alanine tRNA.DepositorArticleInsertsgRNA
UseCRISPRAvailable SinceOct. 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-sgRNA_Target2 (Mpphot)
Plasmid#186727PurposeGateway entry vector for sgRNA (target 2: Mpphot [negative control]). Transient expression of sgRNA (target 2: Mpphot) in plant cells.DepositorInsertsgRNA_Mphot
ExpressionBacterialAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-sgRNA_Target1 (Mpphot)
Plasmid#186726PurposeGateway entry vector for sgRNA (target 1: Mpphot [positive control]). Transient expression of sgRNA (target 1: Mpphot) in plant cells.DepositorInsertsgRNA_Mphot
ExpressionBacterialAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only