We narrowed to 1,648 results for: CAG promoter
-
Plasmid#182380PurposeDual expression construct encoding shRNA-resistant mtIF3 and mito-mTFP1 from separate promotersDepositorInsertsTags3xFlagExpressionMammalianMutationChanged CDS sequence from 'ccacgttcaagtcacga…PromoterCMV promoter and SV40 promoterAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pGG198
Plasmid#165605PurposeReporter plasmid for B1H-dependent expression of the HIS3/GFP operon with two hEGFP protospacers: PS1(upstream of promoter with 'CAGCG' PAM)-lac-PS2(downstream with 'CGGCG' PAM)-HIS3 and GFPDepositorInserthEGFP protospacer ('CGGCG' PAM) downstream of the HIS3/GFP promoter
UseSynthetic BiologyExpressionBacterialMutationSecondary protospacer ('CGGCG' PAM) ins…PromoterlacAvailable SinceJuly 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_V2_CmYLCVp_35sT_ribozyme_AtPDS3_gRNA10
Plasmid#197958PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter and a single AtPDS3 gRNA driven by CmYLCVp and flanked by ribozymes.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterCmYLCVp and pUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB-CA
Plasmid#20960PurposepiggyBac empty vector with Gatweway cassette and CAG constitutive promoterDepositorInsertGateway Destination Vector
UsepiggybacExpressionMammalianAvailable SinceMay 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-RaichuEV-Rac1HRasCT
Plasmid#214818PurposeEncoding a Förster resonance energy transfer (FRET) biosensor for Rac1 activity with cyan and yellow fluorescent protein.DepositorInsertRaichuEV-Rac1HRasCT
TagsHRasCAAXExpressionMammalianPromoterCAG promoterAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pROSA26-ERT2CreERT2
Plasmid#149436PurposeROSA26 targetting vector with tamoxifen-inducible Cre recombinaseDepositorInsertERT2-Cre-ERT2 fusion protein
UseCre/Lox and Mouse TargetingTagsERT2ExpressionMammalianPromoterCAG promoterAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
APX1-H2B-mEos3.2
Plasmid#245522PurposePlasmid for PiggyBac /ITR mediated insertion of H2B-mEos sequence downstream of CAG promoter using Gateway recombination cassetteDepositorInsertH2B-mEos
ExpressionMammalianAvailable SinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pC-GoldyTALEN
Plasmid#38143Purposedestination vector for the Golden Gate TALEN kit, directs expression of TALENs from a truncated CAGs promoterDepositorInsertGoldyTALEN
TagsAcV5 and FokI homodimerExpressionMammalianMutationTruncate at N and C terminousPromoterminiCaggsAvailable SinceJuly 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pROSA26-CreERT2
Plasmid#149437PurposeROSA26 targetting vector with tamoxifen-inducible Cre recombinaseDepositorInsertCre-ERT2 fusion protein
UseCre/Lox and Mouse TargetingTagsERT2ExpressionMammalianPromoterCAG promoterAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTAL-MajSat-FLAG-NLS-VP64
Plasmid#69074PurposeExpresses TALE for mouse major satellite with VP64 and FLAG under CAG promoterDepositorInsertTALE
ExpressionMammalianAvailable SinceSept. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTAL-MajSat-FLAG-NLS-MCS
Plasmid#69073PurposeExpresses TALE for mouse major satellite with FLAG tag under CAG promoterDepositorInsertTALE
ExpressionMammalianAvailable SinceSept. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pROSA26-FlpERT2
Plasmid#149438PurposeROSA26 mouse targeting vector with tamoxifen-inducible Flp recombinaseDepositorInsertFlp-ERT2 fusion protein
UseCre/Lox and Mouse TargetingTagsERT2ExpressionMammalianPromoterCAG promoterAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBT241_(pCA-ATG-intron-tTA2)
Plasmid#36875DepositorInserttTA2
ExpressionMammalianMutationinsertion of a beta-globin intron with a loxP sit…PromoterCAG (chicken beta actin promoter and CMV enhancer)Available SinceJune 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1653_sgSOD1
Plasmid#63711PurposeExpress sgSOD1 in mammalian cells of human.DepositorInsertsgSOD1, CAG promoter, mCherry, puro
ExpressionMammalianAvailable SinceApril 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pATM (pKD-G11)
Plasmid#62690PurposeMammalian expression of amiR-eGFP with a tdTomato gene from the broadly active CAG promoter/enhancerDepositorInsertamiR-eGFP123/amiR-eGFP419/tdTomato
UseRNAiExpressionMammalianAvailable SinceSept. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-miRFP703-eDHFR(69K6)-mSOS1-linkercat
Plasmid#214827PurposeEncoding mSOS1-linkercat fused to miRFP703DepositorInsertmiRFP703-eDHFR(69K6)-mSos1-linkercat
TagsmiRFP703ExpressionMammalianPromoterCAG promoterAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJM597 ZF(2/6)x3 mKate2 in TUPV1
Plasmid#161531PurposeInducible expression of mKate2 under the ZF(2/6)x3 promoterDepositorInsertmKate2
UseSynthetic BiologyExpressionMammalianPromoterZF(2/6)x3Available SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pATN (pKD-G12)
Plasmid#62691PurposeMammalian expression of amiR-eGFP with a tdTomato gene from the broadly active CAG promoter/enhancerDepositorInsertamiR-eGFP419/amiR-eGFP123/tdTomato
UseRNAiExpressionMammalianAvailable SinceSept. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pATL (pKD-G10)
Plasmid#62689PurposeMammalian expression of amiR-eGFP with a tdTomato gene from the broadly active CAG promoter/enhancerDepositorInsertamiR-eGFP419/amiR-eGFP123
UseRNAiExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pATG (pKD-G5)
Plasmid#62684PurposeMammalian expression of amiR-eGFP with a tdTomato gene from the broadly active CAG promoter/enhancerDepositorInserttdTomato/amiR-eGFP123/amiR-eGFP419
UseRNAiExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pATH (pKD-G6)
Plasmid#62685PurposeMammalian expression of amiR-eGFP with a tdTomato gene from the broadly active CAG promoter/enhancerDepositorInserttdTomato/amiR-eGFP419/amiR-eGFP123
UseRNAiExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pATK (pKD-G9)
Plasmid#62688PurposeMammalian expression of amiR-eGFP with a tdTomato gene from the broadly active CAG promoter/enhancerDepositorInserttdTomato/amiR-eGFP123/amiR-eGFP419
UseRNAiExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9 probasin_mTQ2_FlpO
Plasmid#68357PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and 8, and SMAD4 ex2 and ex 9 are expressed by the U6 promoter.DepositorInserts5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9
FlpO recombinase
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianPromoterU6 and synthetic Probasin ARRx2Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_MTOR_Nick_Exon-53_Dual_sgRNA
Plasmid#173211PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and MTOR Nick exon-53 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 sgRNA + MTOR Nick exon-53 sgRNA
UseCRISPR; Prime editing (pe3)ExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_RUNX1_+4_T_to_G_Dual_pegRNA
Plasmid#173212PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and RUNX1 +4 T to G pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + RUNX1 +4 T to G pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSC51
Plasmid#104825PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma.12g075700, Glyma.11g145900 (Drb2ab). Also expresses Cas9 from rolD promoter from Gmubi promoterDepositorInsertGlyma.12g075700, Glyma.11g145900
UseCRISPRExpressionPlantAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
psiCheck2-SV40p-5'UTR-mtIF3(SR)-3xFLAG-3'UTR-CMVp-mito-mTFP1
Plasmid#182378PurposeDual expression construct encoding shRNA-resistant mtIF3 and mito-mTFP1 from separate promotersDepositorInsertsTags3xFlagExpressionMammalianMutationChanged CDS sequence from 'ccacgttcaagtcacga…PromoterCMV promoter and SV40 promoterAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
psiCheck2-SV40p-5'UTR-mtIF3(SR)-3xFLAG-3'UTR-HSVTKp-mCherry
Plasmid#182379PurposeDual expression construct encoding shRNA-resistant mtIF3 and mCherry from separate promotersDepositorInsertsTags3xFlagExpressionMammalianMutationChanged CDS sequence from 'ccacgttcaagtcacga…PromoterHSV TK promoter and SV40 promoterAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-SA-WTmLdlrEx14-gRNA2-N22-HLP-SACas9-HA-OLLAS-spA
Plasmid#206860PurposeAn AAV plasmid with U6 promoter driving a gRNA against LDLR and liver specific HLP promoter driving SaCas9DepositorInsertmLdlr gRNA (Ldlr Mouse)
UseAAV and CRISPRAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
SBC015869
Plasmid#226281PurposeExpresses MsCAD from trc promoter; expresses BsSfp and SrCAR from a separate trc promoter. Biosynthesis of (hydroxy)cinnamyl alcohols from (hydroxy)cinnamic acids.DepositorInserts4'-phosphopantetheinyl transferase Sfp
Cinnamyl alcohol dehydrogenase
Carboxylic acid reductase
ExpressionBacterialAvailable SinceNov. 25, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pX330_SAFB2gRNA12
Plasmid#196106PurposeContains guide RNA to 3' end of mouse SAFB2 gene for safb1/2 dko. Used with Addgene IDs: 196103, 196107, 196108DepositorAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_RUNX1_+1_ATGins_Dual_pegRNA
Plasmid#173213PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and RUNX1 +1 ATG insertion pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + RUNX1 +1 ATG insertion pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC-tracrRNA-PMtU6-26
Plasmid#209191PurposeCloning of sgRNAs for expression in plantsDepositorInsertMtU6-26 SnRNA promoter
UseCloning vectorAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC-tracrRNA-PMtU6-1
Plasmid#209190PurposeCloning of sgRNAs for expression in plantsDepositorInsertMtU6-1 SnRNA promoter
UseCloning vectorAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(sgCXCR1-2)-PGKpuro2ABFP-W
Plasmid#252916PurposeExpression vector for gRNA with Puro and tagBFP selection markersDepositorAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(sgCXCR1-1)-PGKpuro2ABFP-W
Plasmid#252915PurposeExpression vector for gRNA with Puro and tagBFP selection markersDepositorAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2-U3
Plasmid#173156PurposeSingle guide RNA cassette under U3 promoterDepositorInsertsgRNA cassette under U3 promoter
ExpressionPlantPromoterpromoter region of the U3C snRNA gene (Marshallsa…Available SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmIL-6 mut C/EBP
Plasmid#61291Purposedrives luciferase from mouse IL-6 promoter with mutant C/EBP (NF-IL-6) siteDepositorInsertIL-6 promoter (Il6 Mouse)
UseLuciferaseExpressionMammalianMutationMutated C/EBP binding site from ACATTGTGCAATCT to…PromoterIL-6 promoter with mutant C/EBP binding siteAvailable SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
WPXL SOX10 gRNA
Plasmid#101923PurposeSOX10 gRNA used for targeted demethylation is inserted into the WPXL lentiviral backbone.DepositorInsertSOX10 promoter targeting gRNA
UseLentiviralAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(sgCXCR2-2)-PGKpuro2ABFP-W
Plasmid#252918PurposeExpression vector for gRNA with Puro and tagBFP selection markersDepositorAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
-
-
WPXL LEFTY2 gRNA
Plasmid#101924PurposeLEFTY2 gRNA used for targeted demethylation is inserted into the WPXL lentiviral backbone.DepositorInsertLEFTY2 enhancer targeting gRNA
UseLentiviralAvailable SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shCdc20
Plasmid#160954PurposeCdc20 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSico_U6-PLOD2 sgRNA4
Plasmid#136459PurposeExpression of gRNA against human PLOD2DepositorInsertgRNA against human PLOD2 (PLOD2 Synthetic, Human)
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUCsRNAP
Plasmid#182746PurposeSwapping in small RNA promoter, 23-bp spacer sequence, & 19-bp repeats into pJC005 plasmidsDepositorInsertsmall RNA promoter, a 23-bp spacer sequence, & 19-bp repeats
UseCRISPRAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRho-DsRed
Plasmid#11156DepositorAvailable SinceMay 25, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCabp5-DsRed
Plasmid#11157DepositorAvailable SinceApril 13, 2006AvailabilityAcademic Institutions and Nonprofits only