We narrowed to 28,194 results for: sta
-
Plasmid#182969PurposeStably express PalmNanoLuc in mammalian cells via the sleeping beauty transposon system.DepositorInsertPalmNanoLuc
ExpressionMammalianMutationN/AAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
CIAR_pcDNA5/FRT/TO
Plasmid#86502PurposeExpresses CIAR in mammalian cells. Used to generate Flp-In stables.DepositorInsertCIAR (SOS1 Human)
UseFrtExpressionMammalianMutationT968L in SOScatPromoterCMV (tet operator)Available SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCS2z-tal1
Plasmid#164656Purposefor the synthesis of zebrafish tal1 mRNADepositorAvailable SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-1: shALAS-1
Plasmid#22750DepositorAvailable SinceDec. 3, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLVX-mCherry-SPASTIN, F124D
Plasmid#180648PurposeLentiviral expression vector for SPASTIN. Has F124D mutation. Used for generating cell lines. Has N-terminal mCherry tag. Dox-inducible. SPASTIN starts on M87. Internal ID: WISP20-44.DepositorInsertSPASTIN
UseLentiviralTagsmCherryExpressionMammalianMutationStarts at M87, F124D mutation, has siRNA resistan…Available SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBW_0001
Plasmid#102833PurposeBinary vector containing Sr22 Schomburgk allele driven by maize ubiquitin promoter, Sr22 terminatorDepositorAvailable SinceFeb. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-B-pCR
Plasmid#46369DepositorAvailable SinceJuly 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMADM-alpha
Plasmid#36890DepositorInsertsGFP
tdTomato-3Myc
beta-globin intron
Neo
ATG (T)
GFP
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, deleted…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-PAL2
Plasmid#196691PurposeRep/Cap plasmid for the production of PAL2, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationPTQGTVR insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
sTR056
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
3788 pmko-neo A9-1
Plasmid#8878DepositorAvailable SinceJan. 6, 2006AvailabilityAcademic Institutions and Nonprofits only -
3788 pmko-neo A9-3
Plasmid#8880DepositorAvailable SinceJan. 6, 2006AvailabilityAcademic Institutions and Nonprofits only -
HEL binding scFv D44.1
Plasmid#111718PurposeYeast Surface Display of D44.1 as a reference starting point for designDepositorInsertD44.1
Tagscmyc tagExpressionYeastAvailable SinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMSCV_PIG_3XHA-Ago1
Plasmid#170916PurposeExpresses 3X-HA-AGO1DepositorAvailable SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
FLAG-SENP2 C548A
Plasmid#126592PurposeExpresses siRNA resistant SENP2 (catalytic dead) in mammalian cells, Dox inducible in TetR cell linesDepositorAvailable SinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMP71-tCD19-llo-mc38tmg
Plasmid#174603Purposeexpresses the extracellular and transmembrane domain of murine CD19 with a C terminal fusion of the LLO190 and minigenes of 3 neoantigens from the MC38 tumor in genes ADGPK, DPAGT and Reps1DepositorInsertextracell transmem domains moCD19 wCterm fusion LLO190 and minigenes of 3neoantigens MC38tumor in genes ADGPK DPAGT Reps1
ExpressionMammalianAvailable SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_SNORD27h_115mut
Plasmid#73068Purposeexpression clone for human mutated SNORD27 (C/D box snoRNA U27)DepositorInsertSNORD27 (SNORD27 Human)
Tagsno tagExpressionMammalianMutationexpression cassette for SNORD27 with AS box from …Available SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAdTrack shALAS-1
Plasmid#22748DepositorAvailable SinceJuly 14, 2010AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T1-Rpb1-linker
Plasmid#138468PurposeExpresses GST-tagged Rpb1 linker in bacteriaDepositorInsertRpb1 (POLR2A Human)
TagsGSTExpressionBacterialMutationAmino acids 1460-1585PromotertacAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only