We narrowed to 14,561 results for: cas9 genes
-
Plasmid#235994PurposeExpresses Cas9-SpRY in mammalian cellsDepositorInsertSpRY
UseCRISPRExpressionMammalianPromoterEF-1aAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMLS338
Plasmid#73719PurposeSapTrap Single plasmid targeting vector for tagging Unc-32 with GFP by CRISPR/Cas9DepositorInsertUnc-32::GFP(Cbr-unc-119)
UseCRISPR and Cre/LoxExpressionWormAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPN10-gDM1d
Plasmid#114387PurposepPN10 with gRNA for spCRISPR-Cas9 against the 3' UTR of the DMPK gene target: TGCGAACCAACGATAGGTG PAM: GGGDepositorInsertgDM1d
UseCRISPRAvailabilityAcademic Institutions and Nonprofits only -
pPN10-gCTG
Plasmid#114385PurposepPN10 with gRNA for spCRISPR-Cas9 targeted to CTG repeat, PAM: CTGDepositorInsertgCTG
UseCRISPRAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDB4279
Plasmid#98698PurposeA control plasmid containing the intact bsdMX markerDepositorInsertCas9
UseCRISPRExpressionYeastAvailable SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN10-gCAG
Plasmid#114384PurposepPN10 with gRNA for spCRISPR-Cas9 targeted to CAG repeat, PAM: CAGDepositorInsertgCAG
UseCRISPRAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRB1081
Plasmid#71479PurposeExpresses gRNA for dpy-10 conversion using NGAG PAM and VQR Cas9 variantDepositorInsertdpy-10 gRNA
UseCRISPRExpressionWormPromoterU6Available SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRB1084
Plasmid#71516PurposeExpresses gRNA for dpy-10 conversion using NGCG PAM and VRER Cas9 mutantDepositorInsertdpy-10 gRNA
UseCRISPRExpressionWormPromoterU6Available SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV.5’-LMNA-eGFP-KI
Plasmid#170545PurposeExpresses a sgRNA for 5' tagging to LMNA and contains a cassette with eGFP flanked by homology arms for LMNADepositorInsertsLeft Homology arm for LMNA knockin
Right Homology arm for VIM knockin
UseCRISPR and LentiviralAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV.5’VIM-eGFP-KI
Plasmid#170547PurposeExpresses a sgRNA for 5' tagging to VIM and contains a cassette with eGFP flanked by homology arms for VIMDepositorInsertsLeft Homology arm for VIM knockin
Right Homology arm for VIM knockin
UseCRISPR and LentiviralAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSC51
Plasmid#104825PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma.12g075700, Glyma.11g145900 (Drb2ab). Also expresses Cas9 from rolD promoter from Gmubi promoterDepositorInsertGlyma.12g075700, Glyma.11g145900
UseCRISPRExpressionPlantAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDG459
Plasmid#100901PurposeSpCas9 with 2A-Puro and a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of double knock-outs and large deletions in a single plasmid system.DepositorInsertshumanized CRISPR associated protein 9
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTags3xFLAG and T2A-PuroRExpressionMammalianPromoterCBh and U6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMJ922
Plasmid#78312PurposeExpression of His6-MBP-tagged Cas9-NLS-EGFP protein in E. coliDepositorInsertSpCas9
TagsHA-2xNLS-EGFP-NLS and His6-MBP-TEVExpressionBacterialMutationhuman codon-optimized gene sequencePromoterT7Available SinceJune 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
BPK764
Plasmid#65767PurposeBacterial expression plasmid for SpCas9 & sgRNA (need to clone spacer into BsaI sites): T7-humanSpCas9-NLS-3xFLAG-T7-BsaIcassette-Sp-sgRNADepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9-NLS-3XFlag, and SpCas9 gRNA
UseCRISPRTags3x FLAG and NLSExpressionBacterialPromoterT7 (x2)Available SinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSECC
Plasmid#60820Purpose3rd generation vector. Expresses a sgRNA of interest, Cas9 and CreDepositorInsertsCas9
Cre
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingTagsFlagExpressionMammalianMutationBsmBI site eliminated by C->A; E308GPromoterEFS and EFS (after Cas9-2A)Available SinceNov. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.SFFV.GFP
Plasmid#57827PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses eGFP via P2A cleavage site. SFFV Promoter drivenDepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV
P2A-eGFP
UseCRISPR and LentiviralTagsFLAGAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
MSP469
Plasmid#65771PurposeHuman expression vector for SpCas9 VQR variant: CMV-T7-humanSpCas9(D1135V/R1335Q/T1337R)-NLS-3xFLAG (VQR variant)DepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 (D1135V/R1335Q/T1337R)-NLS-3XFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationD1135V, R1335Q, and T1337R mutations in Cas9PromoterCMV & T7Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSP680
Plasmid#65772PurposeHuman expression vector for SpCas9 EQR variant: CMV-T7-humanSpCas9(D1135E/R1335Q/T1337R)-NLS-3xFLAG (EQR variant)DepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 (D1135E/R1335Q/T1337R)-NLS-3XFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationD1135E, R1335Q, and T1337R mutations in Cas9PromoterCMV & T7Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMJ923
Plasmid#78313PurposeExpression of His6-MBP-tagged Cas9-NLS-mCherry protein in E. coliDepositorInsertSpCas9
TagsHA-2xNLS-mCherry-NLS and His6-MBP-TEVExpressionBacterialMutationhuman codon-optimized gene sequencePromoterT7Available SinceJune 7, 2016AvailabilityAcademic Institutions and Nonprofits only