We narrowed to 4,713 results for: crispr c plasmids
-
Plasmid#190432PurposeM13 helper genes cloned into the pSEVA631 vector. This plasmid does not carry an M13 packaging signal. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ297.)DepositorInsertM13 genes: I-XI
UseSynthetic BiologyAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
rat APOBEC1-EGFP
Plasmid#112857Purposeplasmid for the expression of a rat APOBEC1-EGFP C-terminal fusion proteinDepositorInsertapolipoprotein B mRNA editing enzyme, catalytic polypeptide 1 (Apobec1 Rat)
ExpressionMammalianPromoterCMV promoterAvailable SinceAug. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330_PHF19_sgRNA
Plasmid#246404PurposeCas9/sgRNA expression plasmid targeting PHF19DepositorInsertPHF19 (PHF19 Human)
ExpressionMammalianAvailable SinceNov. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP mCherry-ApoB-EGFP
Plasmid#112859PurposePlasmid bearing the editing target of APOBEC1 fused between the mCherry cds and the EGFP one. In presence of APOBEC1, the CAA codon in ApoB is edited to a Stop codon (UAA), leading to loss of EGFPDepositorInsertmCherry-apoB-EGFP
ExpressionMammalianPromoterCMV promoterAvailable SinceOct. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
U6-Nme2_tracr
Plasmid#192146PurposeExpresses Nme2-sgRNA cloned with BspQIDepositorInsertNme2 sgRNA scaffold
UseAAVExpressionMammalianAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRS423-TyrSgH
Plasmid#163973PurposeHelper plasmid for cloning gRNAs under the control of the tRNA(Tyr) promoterDepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFTK087
Plasmid#171359PurposePart Plasmid Entry Vector (LVL0) from the Fungal Modular Cloning ToolKit.DepositorInsertP-ANtRNA[Pro1]-sgRNA-dummy-Esp3I, Pol-III sgRNA-plug-in transcription unit
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFTK086
Plasmid#171358PurposePart Plasmid Entry Vector (LVL0) from the Fungal Modular Cloning ToolKit.DepositorInsertP-ANtRNA[Arg21]-sgRNA-dummy-Esp3I, Pol-III sgRNA-plug-in transcription unit
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRS423-SgH
Plasmid#163972PurposeHelper plasmid for cloning gRNAs under the control of the SNR52 promoter.DepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_MTF2_sgRNA
Plasmid#246402PurposeCas9/sgRNA expression plasmid targeting MTF2DepositorInsertMTF2 (MTF2 Human)
ExpressionMammalianAvailable SinceNov. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS423-ProSgH
Plasmid#163974PurposeHelper plasmid for cloning gRNAs under the control of the tRNA(Pro) promoterDepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV2 for Split-PE, gRNAs + MMLV-RT(dRH)-P2A-eGFP (PKC1002)
Plasmid#190112PurposeAAV2 for expression of pegRNA and ngRNA (HEKs3, CTT insertion) + MMLV-RT(dRH)-P2A-eGFPDepositorInsertsMMLV-RT(dRH)
U6-pegRNA(HEKs3, CTT ins)-H1-ngRNA(HEK s3)
UseAAVTagsbpNLS and bpNLS-P2A-eGFPMutationmutations from RT in PE2 and truncation of RNAse …PromoterEFS and U6, H1Available SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
v1em-Cterm-PE2max-U6-pegRNA
Plasmid#198733PurposeAAV genome encoding C-terminal PE2max and U6 expression cassetteDepositorInsertNpuC-CtermPE2max
UseAAVPromoterEFSAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
scFv-GCN4-DNMT3a-DNMT3l
Plasmid#154140PurposeExpresses the scFv-GCN4-DNMT3a-DNMT3l fusion protein (more details are shown in the vectro map) for targeted DNA methylation. Should be used in a combination with the dCas9-SunTag systems.DepositorInsertscFv-GCN4, DNMT3a (catalytic domain), DNMT3l (C-terminal part), sfGFP
TagsHA and sfGFPExpressionMammalianPromoterSFFVAvailable SinceOct. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCFJ150-Cas9(dpiRNA)
Plasmid#107940Purposeeft-3p::Cas9(dpiRNA)::tbb-2 3'UTR construct used for MosSCI in nematode. Cas9 is optimized by removing all piRNA targeting sites to allow germline expression.DepositorInsertCas9(dpiRNA)
ExpressionWormPromotereft-3Available SinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-TAC-OKMS-Cas9
Plasmid#120353PurposepiggyBac transposon for dox-inducible expression of the OKMS (Oct4, Klf4[10-483], c-Myc, Sox2) polycistronic reprogramming cassette (with mCherry). SpCas9 is constitutively expressed.DepositorInsertOKMS cassette
UseCRISPR; Piggybac transposonExpressionMammalianMutationKlf4 [10-483]Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTij_sg_mmu_Med6_C_terminal
Plasmid#197869PurposeCRISPR/Cas9/sgRNA plasmid for cutting Med6 C terminal and building MED6-mEmerald/Halo knock-in mESCsDepositorAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-H2BC11_sgRNA
Plasmid#183881PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and H2BC11 sgRNA for C-terminal tagging of H2B histones in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-TAC-OKMS-KRAB-dCas9
Plasmid#120356PurposepiggyBac transposon for dox-inducible expression of the OKMS (Oct4, Klf4[10-483], c-Myc, Sox2) polycistronic reprogramming cassette (with mCherry). KRAB-dCas9 is constitutively expressed.DepositorInsertOKMS cassette
UseCRISPR; Piggybac transposonExpressionMammalianMutationKlf4 [10-483]Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only