We narrowed to 6,971 results for: crispr cas9 plasmids
-
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLM-AMA15.0 Cas9
Plasmid#138944PurposeFungal AMA1 plasmid with sp-Cas9, ribozymes based "plug-and-play" sgRNA transcription unit, Terbinafine and Phleomycin selection markersDepositorInsertp40S:sp_Cas9_2xNLS; HH-HDV sgRNA transcription unit, Terbinafine (ergA) and Phleomycin (ble) selection markers
UseCRISPR and Synthetic Biology; Ama1 autonomously r…TagsNLSExpressionMutationPromoterp40S (AN0465) Aspergillus nidulansAvailable sinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SMVP-Cas9C
Plasmid#80931PurposeExpresses Cas9C in mammalian cells.DepositorInsertCas9C
UseAAV, CRISPR, and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCW-Cas9-2A-EGFP
Plasmid#167928PurposeDoxycycline-inducible Cas9 expression tracked by EGFP fluorescence marker.DepositorInsertT2A-EGFP
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromotertTRE, hPGKAvailable sinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
1137=Hsp70Bb-Cas9[dsRed]
Plasmid#149424PurposeThe piggyBac plasmid harboring Hsp70Bb-Cas9-T2A-eGFP-p10 and Opie2-dsRed-SV10 (marker gene)DepositorInsertCas9
UseCRISPRTagseGFPExpressionInsectMutationPromoterDmel Hsp70BbAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro-V2.0-sg1HsAGO2_AH
Plasmid#148848PurposeMammalian Expression of HsAGO2-sgRNA1DepositorInsertHsAGO2-sgRNA1 (AGO2 S.pyogenes)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro-V2.0-sg2HsAGO2_AH
Plasmid#148851PurposeMammalian Expression of HsAGO2-sgRNA2DepositorInsertHsAGO2-sgRNA2 (AGO2 S.pyogenes)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro-V2.0-sgHsAGO1_AH
Plasmid#148854PurposeMammalian Expression of HsAGO1-sgRNADepositorInsertHsAGO1-sgRNA (AGO1 S.pyogenes)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro-V2.0-sgHsNot1_AH
Plasmid#148856PurposeMammalian Expression of HsNot1-sgRNADepositorInsertHsNot1-sgRNA (CNOT1 S.pyogenes)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
BB3cH_pGAP_23*_pPFK300_Cas9
Plasmid#104912PurposehCas9 under control of pPFK300 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on HygDepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceJan. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
BB3cK_pGAP_23*_pPFK300_Cas9
Plasmid#104910PurposehCas9 under control of pPFK300 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on G418DepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
BB3cK_pGAP_23*_pLAT1_Cas9
Plasmid#104908PurposehCas9 under control of LAT1 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on G418DepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
BB3cN_pGAP_23*_pLAT1_Cas9
Plasmid#104906PurposehCas9 under control of LAT1 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on NTCDepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceFeb. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP (PX458)
Plasmid#48138PurposeCas9 from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNADepositorHas ServiceCloning Grade DNAInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianMutationPromoterCbhAvailable sinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-GFP (PX461)
Plasmid#48140PurposeCas9n (D10A nickase mutant) from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNADepositorInserthSpCas9n
UseCRISPRTags3XFLAG and GFPExpressionMammalianMutationCas9 D10A nickase mutantPromoterCbhAvailable sinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pX330-BsaIx2-DD-Cas9
Plasmid#75380PurposeExpresses DD-SpCas9 in mammalian cells and has a cloning site for an sgRNA. The FKBP12 L106P destabilization domain allows for inducible stabilization of Cas9 through the addition of Shield-1DepositorInsertDD-SpCas9
UseCRISPRTagsFKBP12 L106P DDExpressionMammalianMutationPromoterCAGAvailable sinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNHEJ-Cas9-recX
Plasmid#158715PurposeCRISPR-assisted-NHEJ system used for genome editing in Mycobacterium smegmatis. Helper plasmid expresses Cas9, NHEJ machinery of M. marinum and recXDepositorInsertcas9
UseCRISPRTagsExpressionBacterialMutationPromoterTetOAvailable sinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)_CBh-Cas9-T2A-mCherry
Plasmid#64324PurposeExpression vector for sgRNAs cloned into the BbsI sites and for expression of Cas9 linked to mCherry via a T2A peptideDepositorInsertsCas9
sgRNA cassette
UseCRISPRTags3xFLAG, NLS, and T2A-mCherryExpressionMammalianMutationPromoterCBh and U6Available sinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)_CBh-Cas9-T2A-BFP
Plasmid#64323PurposeExpression vector for sgRNAs cloned into the BbsI sites and for expression of Cas9 linked to BFP via a T2A peptideDepositorInsertsCas9
sgRNA cassette
UseCRISPRTags3xFLAG, NLS, and T2A-EBFP2ExpressionMammalianMutationPromoterCBh and U6Available sinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
dCas9 fused to scFv (anti-spike)
Plasmid#186421PurposeExpression of dCas9 with C-terminal nanobody fusion recognizing spike protein from SARS-CoV-2DepositorInsertdCas9-scFv fusion (anti-SARS-CoV-2 spike)
UseCRISPRTags6HisExpressionMutationPromoterAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only