We narrowed to 7,493 results for: Ank
-
Plasmid#227959PurposeBioID experimentDepositorAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pGL4.23-hs737
Plasmid#222472PurposeLuciferase vector containing the hs737 enhancer sequence (reference sequence).DepositorAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCI AscI MR1 res
Plasmid#214752Purposeexpresses human MR1 resistant to CRISPR editing with a specific sgRNA in mammalian cellsDepositorInsertMHC class I-related protein 1 (MR1 Human)
TagsIRES eGFPExpressionMammalianMutationsilent mutations to prevent editing by CRISPR/Cas…PromoterCMVAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-TNFSF11-Fc(DAPA)-AviTag-6xHis
Plasmid#156700PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertTNFSF11 (TNFSF11 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
mGFP-hNET-A457P
Plasmid#193365Purposeexpression of mutated human norpinephrine transporter tagged with monomeric GFP at the N-terminus in mammalian cellsDepositorInserthuman Norepinephrine Transporter (A457P mutation) (SLC6A2 Human)
Tagsmonomeric GFP (mGFP)ExpressionMammalianMutationA457P (GCC to CCC)PromoterCMVAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
mGFP-hNET-R121A/K334A/R440A
Plasmid#193366Purposeexpression of mutated human norpinephrine transporter tagged with monomeric GFP at the N-terminus in mammalian cellsDepositorInserthuman Norepinephrine Transporter (SLC6A2 Human)
Tagsmonomeric GFP (mGFP)ExpressionMammalianMutationR121A (CGG to GCG) K334A (AAA to GCA) R440A (CGA …PromoterCMVAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1-del1097-1110-IKGRQtoDSYAA-shRNAres_W
Plasmid#147897PurposeMammalian Expression of HsNot1iso1-del1097-1110-IKGRQtoDSYAA-shRNAresDepositorInsertHsNot1iso1-del1097-1110-IKGRQtoDSYAA-shRNAres (CNOT1 Human)
ExpressionMammalianMutation10 silent mutations and two non silent N605S, K75…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1-del1097-1110-NF1144AA-shRNAres_W
Plasmid#147898PurposeMammalian Expression of HsNot1iso1-del1097-1110-NF1144AA-shRNAresDepositorInsertHsNot1iso1-del1097-1110-NF1144AA-shRNAres (CNOT1 Human)
ExpressionMammalianMutation1 silent mutation and one non silent mutation R23…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1-del1097-1110-R1138A-shRNAres_W
Plasmid#147899PurposeMammalian Expression of HsNot1iso1-del1097-1110-R1138A-shRNAresDepositorInsertHsNot1iso1-del1097-1110-R1138A-shRNAres (CNOT1 Human)
ExpressionMammalianMutation1 silent mutation and one non silent mutation R23…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1_1-1605-del1079-1110-RNFtoAAA-shRNAres_W
Plasmid#147886PurposeMammalian Expression of HsNot1iso1_1-1605-del1097-1110-RNFtoAAA-shRNAresDepositorInsertHsNot1iso1_1-1605-del1097-1110-RNFtoAAA-shRNAres (CNOT1 Human)
ExpressionMammalianMutation1 silent mutation compared to the sequence of iso…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1_1-1605-del1097-1110-RNFIKGRQtoAAADSYAA-shRNAres_W
Plasmid#147887PurposeMammalian Expression of HsNot1iso1_1-1605-del1097-1110-RNFIKGRQtoAAADSYAA-shRNAresDepositorInsertHsNot1iso1_1-1605-del1097-1110-RNFIKGRQtoAAADSYAA-shRNAres (CNOT1 Human)
ExpressionMammalianMutation1 silent mutation compared to the sequence of iso…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-nE-mHP1alpha
Plasmid#181895PurposeFluorescently tagged HP1alpha, serines in N-terminal extension (NTE) replaced by glutamatesDepositorInsertnE-mHP1alpha (Cbx5 Mouse)
TagsGFPExpressionMammalianMutationS11E, S12E, S13E, S14EPromoterCMVAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(FCA)-6xHis-NLS(SV40)
Plasmid#185701PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(FCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(FCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(PDCA)-6xHis-NLS(SV40)
Plasmid#185705PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(PDCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(PDCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(SCA)-6xHis-NLS(SV40)
Plasmid#185703PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(SCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(SCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(PCA)-6xHis-NLS(SV40)
Plasmid#185704PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(PCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(PCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(BCA)-6xHis-NLS(SV40)
Plasmid#185702PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(BCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(BCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only