We narrowed to 23,734 results for: promoter
-
Plasmid#63027PurposeTo express Gal4 in the pattern of the Drosophila melanogaster odorant receptor Or30a, using the promoter sequences of the gene cloned 5' of Gal4DepositorInsertDrosophila melanogaster Or30a promoter
TagsDrosophila ADH (aa's 1-18) fused to Yeast Ga…ExpressionInsectAvailable SinceApril 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pWZL blast goosecoid
Plasmid#14095DepositorAvailable SinceFeb. 22, 2007AvailabilityAcademic Institutions and Nonprofits only -
3158 pSFFV-neo Bad cDNA
Plasmid#8753DepositorAvailable SinceJuly 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pTL472
Plasmid#69882PurposedCirl promoter region was replaced with an optimized 20xUAS-IVS promoter cassetteDepositorAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT/TO MycLAP-STIL ∆CC
Plasmid#80268Purposemammalian expression plasmid for MycLAP-STIL coiled-coil deletionDepositorInsertSTIL (STIL Human)
TagsMyc-GFPExpressionMammalianMutationmissing conserved coiled-coil (amino acids 721-74…PromoterCMVAvailable SinceAug. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
C513-E07: attB5r-<p10p-polyhedrinp>-attB1r
Plasmid#162949PurposeGateway attB5r/attB1r entry clone containing divergent AcMNPV polyhedrin and p10 promoters, for use in construction of polycistronic baculovirus expression vectorsDepositorInsertdual baculovirus promoter cassette (AcMNPV p10 and polyhedrin)
UseSynthetic BiologyAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site3 (RTW549)
Plasmid#160138PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #3DepositorInsertAsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLX-V5-TRAF2 S11A-puro
Plasmid#44112DepositorAvailable SinceJuly 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
Or45b-Gal4
Plasmid#63036PurposeTo express Gal4 in the pattern of the Drosophila melanogaster odorant receptor Or45b, using the promoter sequences of the gene cloned 5' of Gal4DepositorInsertDrosophila melanogaster Or45b promoter
TagsDrosophila ADH (aa's 1-18) fused to Yeast Ga…ExpressionInsectAvailable SinceApril 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEM01
Plasmid#135414PurposeExpression of Hygromycin resistance from CMV promoterDepositorInsertCMVpr hph ADH1t
ExpressionBacterial and YeastPromoterCMVprAvailable SinceMay 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
TOPO CMV
Plasmid#68454PurposeTOPO construct expressing CMV for generation of GMAP-compatible promoterDepositorInsertCytomegalovirus Immediate-Early Promoter
UseGmapExpressionBacterialPromoterPlacAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
mCitrine-USP19 1-1290
Plasmid#78595PurposeExpress mCitrine-USP19 1-1290 in mammalian cellsDepositorAvailable SinceJune 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLX-V5-TRAF2 S102A-puro
Plasmid#44113DepositorAvailable SinceApril 2, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDD2002
Plasmid#101198PurposeName: pCBG68-LANApi. LANApi driving green luciferase reporter for CBG68 in pCBG68 backbone.DepositorInsertLANApi driving green luciferase reporter for CBG68 in pCBG68 backbone.
UseLuciferaseAvailable SinceApril 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDD2005
Plasmid#101219PurposeName: pCBR-K14. K14 driving red luciferase reporter for CBR in pCBR backbone.DepositorInsertK14 driving red luciferase reporter for CBR in pCBR backbone.
UseLuciferaseAvailable SinceApril 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
px330BRG1 gRNA
Plasmid#165585PurposeInsertion of BRG1 degronDepositorAvailable SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFlox c-SPT5_EYFP_FKBPF36V_Neo
Plasmid#163872PurposeAcute Depletion of SPT5-EYFPDepositorInsertSpt5 (Supt5 Mouse)
ExpressionMammalianAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFlox_N-BRG1_BSD_FKBPF36V_EYFP
Plasmid#163874PurposeAcute Depletion of BRG1-EYFPDepositorInsertBrg1 (Smarca4 Mouse)
ExpressionMammalianAvailable SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-GFP (F64L, S65T, V163A)-kanMX6
Plasmid#53183Purposechromosomal tagging with stable GFPDepositorInsertkanMX6
UseYeast genomic targetingTagsGFP (F64L, S65T, V163A)Available SinceMay 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
3156 pBS Bad cDNA
Plasmid#8752DepositorInsertBAD (Bad Mouse)
ExpressionBacterialAvailable SinceNov. 2, 2005AvailabilityAcademic Institutions and Nonprofits only