We narrowed to 11,503 results for: ENA
-
Plasmid#171138PurposeFor integration of Sp.pCas9-dCas9 and BBa_J23107-MCP-SoxS(R93A/S101A) with miniTn7T methodDepositorInsertSp.pCas9-dCas9_BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPRExpressionBacterialMutationSoxS has R93A and S101A mutationsPromoterSp.pCas9, BBa_J23107Available SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetO-GFP-mSox2
Plasmid#206374PurposeExpresses EGFP fused mouse SOX2 in mammalian cells, for lentivirus generation.DepositorAvailable SinceOct. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-TNKS-2
Plasmid#154149PurposeFor making TNKS-2 RNADepositorAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf196
Plasmid#12884PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf196
ExpressionMammalianAvailable SinceDec. 13, 2006AvailabilityAcademic Institutions and Nonprofits only -
pYPQ292 (AaCas12b)-D570A-TV-MS2-TV
Plasmid#136381PurposeCRISPRa Gateway entry clone for catalytically dead AaCas12b (D570A) fused with TV activation system, followed by T2A and MCP-TV fusion proteinDepositorInsertAaCas12b (D570A)-TV-T2A-MCP-TV
UseCRISPRExpressionPlantMutationD570AAvailable SinceFeb. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pChlr-8CQ
Plasmid#52171PurposeEncodes module 8 with amino acids 12C-16Q for recognition of nt 1ADepositorInsertPumilio homology domain amino acids 284-319 (PUM1 Human)
ExpressionBacterialMutationChanged 12N to 12C in module 8Available SinceApril 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPKm-196
Plasmid#90511PurposepcDNA3 - CMVmin PIF6-DBD, expressing PIF6-DBD under CMV promoterDepositorInsertPIF6-DBD
ExpressionMammalianAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
SpyCas9 PE2-3HA
Plasmid#169853PurposeMammalian Expression, SpyCas9 prime editor with 3HA-tagDepositorInsertSpCas9-H840A-M-MLV-3HA
Tags3XHA tag and bpSV40 NLSExpressionMammalianPromotercmvAvailable SinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pETNKI-strepII-3C-LIC-kan
Plasmid#108706PurposeExpression of a StrepII-tagged target protein with 3C protease cleavage site.DepositorTypeEmpty backboneTagsStrepII-3C protease cleavage siteExpressionBacterialPromoterT7Available SinceAug. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_25I
Plasmid#91146PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:Csy4-P2A-TaCas9_dead + PvUbi1:gRNAs with Csy4 spacers, Plant Selection: PvUbi2:hpt IIDepositorInsertEngineering Reagent: ZmUbi:Csy4-P2A-TaCas9_dead + PvUbi1:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLL7.0-iRFP670-micro
Plasmid#135954PurposeExpresses an iLID micro (SspB R73Q)-iRFP670 fusion in mammalian cells.DepositorInsertiLID micro (SspB R73Q)
UseLentiviralTagsiRFP670ExpressionMammalianPromoterCMVAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDsRed2-C1-Ahi1
Plasmid#30495DepositorAvailable SinceJune 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
BRD4 CRISPRi plasmid
Plasmid#154890PurposeHuman BRD4 CRISPRi gRNADepositorInsertBRD4-targeting gRNA
UseCRISPR and LentiviralAvailable SinceJuly 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_25G
Plasmid#91144PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:TaCas9_dead + TaU6:gRNA , Plant Selection: PvUbi2:hpt IIDepositorInsertEngineering Reagent: ZmUbi:TaCas9_dead + TaU6:gRNA
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf117
Plasmid#12805PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf117
ExpressionMammalianAvailable SinceDec. 8, 2006AvailabilityAcademic Institutions and Nonprofits only -
E1010m (RFP)_CD
Plasmid#66033PurposeMoClo Basic Part: CDS - Fluorescent protein. Red. Modified from Bba_E1010 to fix illegal sites. [C:E1010m:D]DepositorInsertFluorescent reporter - RFP
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRvCAHS1-mEGFP-NLS
Plasmid#205013PurposeThe vector contains 1kbp of the upstream and downstream regions of the cahs1 gene from Ramazzottius varieornatus, with the mEGFP gene with NLS sequence positioned in between.DepositorInsertmEGFP-NLS flanked by 1kbp upstream and downstream of the cahs1 gene from Ramazzottius varieornatus
UseTardigrade expressionAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRvSAHS1-mCherry-NLS
Plasmid#205009PurposeThe vector contains 1kbp of the upstream and downstream regions of the sahs1 gene from Ramazzottius varieornatus, with the mCherry gene with NLS sequence positioned in between.DepositorInsertmCherry-NLS flanked by 1kbp upstream and downstream of the sahs1 gene from R. varieornatus
UseTardigrade expressionAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha1 clone2
Plasmid#162120PurposeLentiviral sgRNA plasmid targeting human AMPK alpha1DepositorInsertsgAMPK alpha1 (PRKAA1 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only