We narrowed to 62,473 results for: Ide
-
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pLEX_305-N-dTAG-FRA1
Plasmid#188742Purposeexpresses murine Fosl1 (Fra1) with N-terminal tag FKBP F36V (dTAG) for the dTAG systemDepositorInsertFosl1 (Fosl1 Mouse)
UseLentiviralTagsFKBP F36V tag (dTAG)ExpressionMammalianPromoterhPGK promoterAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX_305-N-dTAG-FRA1
Plasmid#188742Purposeexpresses murine Fosl1 (Fra1) with N-terminal tag FKBP F36V (dTAG) for the dTAG systemDepositorInsertFosl1 (Fosl1 Mouse)
UseLentiviralTagsFKBP F36V tag (dTAG)ExpressionMammalianPromoterhPGK promoterAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSumo24P7vB4
Plasmid#113073PurposePlasmid for highly efficient expression of engineered IL24 with binding affinity to cognate receptorsDepositorInsertHuman IL-24 engineered by computational design and fused with N-terminal SUMO tag (IL24 SUMO part (Brachypodium distachyon), Human)
TagsSUMOExpressionBacterialMutationQ60R, K62E, K68E, K77R, M80L, S88D, A89V, Q93R, Q…PromoterT7Available SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSumo24P7vB4
Plasmid#113073PurposePlasmid for highly efficient expression of engineered IL24 with binding affinity to cognate receptorsDepositorInsertHuman IL-24 engineered by computational design and fused with N-terminal SUMO tag (IL24 SUMO part (Brachypodium distachyon), Human)
TagsSUMOExpressionBacterialMutationQ60R, K62E, K68E, K77R, M80L, S88D, A89V, Q93R, Q…PromoterT7Available SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSumo24P7
Plasmid#113072PurposePlasmid for highly efficient expression of engineered IL24 with mutated binding sitesDepositorInsertHuman IL-24 engineered by computational design and fused with N-terminal SUMO tag (IL24 SUMO part (Brachypodium distachyon), Human)
TagsSUMOExpressionBacterialMutationQ60R, K62E, K68E, K77R, M80L, S88D, A89V, Q93R, Q…PromoterT7Available SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSumo24P7
Plasmid#113072PurposePlasmid for highly efficient expression of engineered IL24 with mutated binding sitesDepositorInsertHuman IL-24 engineered by computational design and fused with N-terminal SUMO tag (IL24 SUMO part (Brachypodium distachyon), Human)
TagsSUMOExpressionBacterialMutationQ60R, K62E, K68E, K77R, M80L, S88D, A89V, Q93R, Q…PromoterT7Available SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHBT-KRAS174
Plasmid#248050PurposeTo express His6 tag-Avi tag-TEV cleavage site-KRAS (residues 1-174) in E. coli, under the T7 promoter.DepositorInsertKRAS (KRAS Human)
TagsHis6 tag-Avi tag-TEV cleavage siteExpressionBacterialMutationincludes aa 1-174 onlyPromoterT7Available SinceNov. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHBT-KRAS174
Plasmid#248050PurposeTo express His6 tag-Avi tag-TEV cleavage site-KRAS (residues 1-174) in E. coli, under the T7 promoter.DepositorInsertKRAS (KRAS Human)
TagsHis6 tag-Avi tag-TEV cleavage siteExpressionBacterialMutationincludes aa 1-174 onlyPromoterT7Available SinceNov. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
CIDAR MoClo Extension, Volume I
Plasmid Kit#1000000161PurposeThis kit contains 110 plasmids designed to quickly and efficiently build a wide variety of gene expression constructs using the CIDAR-standard MoClo system.DepositorAvailable SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-dTom-nlsdTom
Plasmid#135630PurposeAAV vector to drive the expression of dTomato in PV cortical interneurons under the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertdTom-nlsdTom
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-dTom-nlsdTom
Plasmid#135630PurposeAAV vector to drive the expression of dTomato in PV cortical interneurons under the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertdTom-nlsdTom
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-GFP-fGFP
Plasmid#135631PurposeAAV vector to drive the expression of fGFP in PV cortical interneuronsunder the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertGFP-fGFP
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-GFP-fGFP
Plasmid#135631PurposeAAV vector to drive the expression of fGFP in PV cortical interneuronsunder the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertGFP-fGFP
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-GCaMP6f
Plasmid#135632PurposeAAV vector to drive the expression of GCaMP6f in PV cortical interneuronsunder the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertGCaMP6f
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-GCaMP6f
Plasmid#135632PurposeAAV vector to drive the expression of GCaMP6f in PV cortical interneuronsunder the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertGCaMP6f
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-Gq-P2A-dTomato
Plasmid#135635PurposeAAV vector to drive the expression of Gq-DREADD-P2A-dTomato in PV cortical interneuronsunder the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertGq-P2A-dTomato
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-Gq-P2A-dTomato
Plasmid#135635PurposeAAV vector to drive the expression of Gq-DREADD-P2A-dTomato in PV cortical interneuronsunder the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertGq-P2A-dTomato
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-ChR2-mCherry
Plasmid#135634PurposeAAV vector to drive the expression of ChR2-mCherry in PV cortical interneuronsunder the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertChR2-mCherry
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-ChR2-mCherry
Plasmid#135634PurposeAAV vector to drive the expression of ChR2-mCherry in PV cortical interneuronsunder the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertChR2-mCherry
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only