We narrowed to 15,240 results for: 11
-
Plasmid#65424PurposeRhoC CA biosensor single chain; mCerulean-tagged ROCK-RBD, mVenus-tagged RhoC Q63LDepositorInsertRBD, mCerulean, mVenus, RhoC
ExpressionBacterial, Insect, and Mamm…MutationT153M in mVenus, Q63L in RhoCAvailable SinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
RhoC FLARE.sc mCer, mVenus - DN
Plasmid#65423PurposeRhoC DN biosensor single chain; mCerulean-tagged ROCK-RBD, mVenus-tagged RhoC T19NDepositorInsertRBD, mCerulean, mVenus, RhoC
ExpressionBacterial, Insect, and Mamm…MutationT153M in mVenus, T19N in RhoCAvailable SinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFosill-2
Plasmid#89696Purposeto make Fosmids that can be converted into Illumina sequencable librariesDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFBD-ESCRT 0
Plasmid#21499DepositorInsertpFastBac Dual-His/MBP/Hrs-GST/STAM1 (STAM Human, Mouse)
TagsGST and His-MBPExpressionInsectMutationnoneAvailable SinceSept. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nucGFP11-3xControlgRNA
Plasmid#224568PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), three Control gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)MutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCJH002_10xHis-MBP-TEVcs-Cas12c(4)_Amp
Plasmid#183069PurposeBacterial protein expression plasmid of wild-type Cas12c_4. This is a R965H version of the Cas12c in Harrington et al., 2020.DepositorInsertCas12c_4
UseCRISPRTagsHis10 and MBPExpressionBacterialMutationWild-typeAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT005
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNAS1B split mCherry N-link/link-C
Plasmid#61965PurposeNegative control duet plasmid for split mCherry assembly assay (i.e., neither half of mCherry is fused to another peptide or protein)DepositorInsertsN-mCherry-link
link-C-mCherry
ExpressionBacterialPromoterPBAD and PLtetOAvailable SinceFeb. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFosill-4
Plasmid#89698Purposeto make Fosmids that can be converted into Illumina sequencable librariesDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSG424 Smad2 (Gal4-Smad2)
Plasmid#14932DepositorAvailable SinceMay 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pPLtetO-ClpX
Plasmid#89657PurposePlasmid for titrating synthesis of ClpX with doxycyclineDepositorInsertclpX
UseSynthetic BiologyAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1272
Plasmid#44486DepositorInsertMinimal Mos1, MCS
UseMultiple cloning site vectorAvailable SinceJuly 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTAJAK-71 (pESC-NatMXsyn-USER)
Plasmid#78232PurposeEmpty vector, for the insertion of gRNA expression cassettes into the vector.DepositorTypeEmpty backboneExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas_5+7_gfp
Plasmid#60595Purposeencodes a reversed Int7 gene flanked by the attB/P sites of Int5, as well as a reversed GFP (GFPmut33) gene flanked by the attB/P sites of Int7.DepositorInsertCas_5+7_gfp
ExpressionBacterialAvailable SinceApril 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nDsRedFL-miR9/9*
Plasmid#177805PurposeThe pre-miR-9/9* sequence has been inserted into the EcoRV of pCAG-nDsRedFL-intron.DepositorInsertmiR-9/9*
ExpressionMammalianAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pReporter_5
Plasmid#60566PurposeA reporter plasmid containing the attB and attP sites flanking a green fluorescent protein reporter gene (gfp).DepositorInsertReporter_5
ExpressionBacterialPromoterBBa_J23119Available SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
3539 pMIG Bax
Plasmid#8788DepositorAvailable SinceJuly 18, 2006AvailabilityAcademic Institutions and Nonprofits only -
pMSC236
Plasmid#216368PurposexhNup155-Nb2i (+2Cys) Nanobody productionDepositorInsertxhNup155-Nb2i (+2Cys)
UseAffinity Reagent/ AntibodyTags14xHis-NEDD8ExpressionBacterialAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSC235
Plasmid#216372PurposexhNup155-Nb3i (+2Cys) Nanobody productionDepositorInsertxhNup155-Nb3i (+2Cys)
UseAffinity Reagent/ AntibodyTags14xHis-NEDD8ExpressionBacterialAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSC227
Plasmid#216351PurposexhNup35-Nb1t (+3Cys) Nanobody productionDepositorInsertxhNup35-Nb1t (+3Cys)
UseAffinity Reagent/ AntibodyTags14xHis-NEDD8ExpressionBacterialAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only