We narrowed to 38,355 results for: gfp
-
Plasmid#31485DepositorInsertSFFV d20BFP T2A BFP
UseLentiviralMutationGFP has 20 amino acids deleted from the C terminu…Available SinceAug. 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Pur-CAG-EGFP
Plasmid#80945Purposehuman AAVS1 site targeting donor plasmid for knocking-in EGFP expression cassette driven by CAG promoterDepositorInsertEGFP
ExpressionMammalianPromoterCAG promoterAvailable SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-DTR-GFP
Plasmid#124364Purposeconditional expression of a diphtheria toxin receptor (DTR)–GFP fusion proteinDepositorHas ServiceAAV2InsertDTR-GFP
UseAAVTagsGFPPromoterChicken B-actinAvailable SinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLPCX cyto Grx1-roGFP2
Plasmid#64975PurposeMammalian expression of cytosolic Grx1-roGFP2 (retroviral vector)DepositorAvailable SinceJune 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSpot-Tag-GFP-GPI
Plasmid#117061PurposeFor mammalian expression of GPI-anchored GFP with N-terminal Spot-TagDepositorInsertGPI-anchored GFP
TagsGPI-anchor and Spot-TagExpressionMammalianPromoterCMVAvailable SinceOct. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
Str-Ii_VSVG-SBP-EGFP
Plasmid#65300Purposesynchronize trafficking of VSVG from the ER (RUSH system)DepositorInsertVSV-G
TagsEGFP and Streptavidin Binding Protein (SBP)ExpressionMammalianPromoterCMVAvailable SinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
TetOn-mCherry-eGFP-RAMP4
Plasmid#109014PurposeTet-On construct to induce expression of tandem eGFP-mCherry tagged RAMP4 (ER marker)DepositorInsertRAMP4 (SERP1 Human)
UseLentiviralTagsmCherry-eGFPExpressionMammalianPromoterCMV promoterAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZ M2rtTA_CAGG TetON-Sox10 with GFP
Plasmid#115241PurposeRMCE donor vector for inducible expression of SOX10 and GFP and constitutive expression of m2rtTA (generated from plasmid #112668)DepositorAvailable SinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-Pol2-ffLuc2-eGFP
Plasmid#71394PurposeLentiviral vector of luciferase-eGFP fusion gene driven by Pol2 promoterDepositorInsertPol2-ffLuc2-eGFP
UseLentiviralExpressionMammalianPromoterPol2 (mouse RNA polymerase II gene promtoer)Available SinceDec. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEF5B-FRT-GFP-αTAT1
Plasmid#27099DepositorInsertα-Tubulin K40 acetyltransferase1 (ATAT1 Human)
TagsGFP, S-tag, and TEV siteExpressionMammalianPromoterEF1aAvailable SinceJan. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
pUC18T-mini-Tn7T-Tp-gfpmut3
Plasmid#65033PurposeTpR mini-Tn7 vector, mobilizable, for GFP tagging bacteriaDepositorInsertgfpmut3
ExpressionBacterialAvailable SinceJuly 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDest eGFP MBNL1 42 kDa
Plasmid#61277PurposeMammalian expression of EGFP-tagged human MBNL1DepositorAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBABE-puro-GFP-progerin
Plasmid#17663DepositorAvailable SinceMarch 27, 2008AvailabilityAcademic Institutions and Nonprofits only -
pGW1-mCherry-EGFP-PIM
Plasmid#111759PurposeHigh expression of mCherry-EGFP-PIM. Can be used for inducible aggregate formation upon AP20187 additionDepositorInsert2x FKBP homo-mCherry-EGFP-2x FKBP homo-2x FKBP
ExpressionMammalianMutationVal24Glu, Tyr80Cys, Ala95Thr mutations in second …PromoterCMVAvailable SinceOct. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-Cas9-2A-GFP-sgRNA
Plasmid#124889PurposeContains spCas9-2A-GFP and guide RNA scaffold in single retroviral vectorDepositorInsertCas9
UseRetroviralTags2A-GFPPromoterMSCVAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-GFP-Fishell-1
Plasmid#83900PurposeGFP expression in forebrain GABA-ergic interneurons under the control of the mDlx enhancer elementDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InserteGFP
UseAAVPromotermDlxAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
Str-Golgin84_VSVG-SBP-EGFP
Plasmid#65305Purposesynchronize trafficking of Golgin-84 from the Golgi apparatus (RUSH system)DepositorInsertGolgin-84 (GOLGA5 Human)
TagsEGFP and Streptavidin Binding Protein (SBP)ExpressionMammalianPromoterCMVAvailable SinceAug. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Empty)-PGKmCherry2AGFP-W
Plasmid#67981PurposeCas9 activity reporter (control) with mCherry and GFPDepositorInsertU6gRNA cassette, PGKmCherry2AGFP cassette, WPRE
UseCRISPR and LentiviralMutationDeleted BbsI site within WPREAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pENTR5'_ubi:loxP-EGFP-loxP
Plasmid#27322DepositorInsertubiquitin:loxP-EGFP-loxP
UseMultisite gateway 5' entry vectorAvailable SinceApril 5, 2011AvailabilityAcademic Institutions and Nonprofits only