We narrowed to 52,745 results for: PLE
-
Plasmid#108973PurposeSelflabeling tag at succinate dehydrogenase complex subunit B (SDHB)DepositorInsertsuccinate dehydrogenase complex iron sulfur subunit B (SDHB Human)
TagsHalo7-tagExpressionMammalianPromoterCMVAvailable SinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mTcte1-PA
Plasmid#176469PurposeExpression vector of mouse t-complex-associated testis expressed 1 (Tcte1) tagged with PA at C-terminus.DepositorAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDY118A
Plasmid#182958PurposepSC101 ori, chl34 resistant. Cas9 induced at 0.4 μg/ml anhydrotetracycline, recombineering proteins induced by a 15 min heat-shock at 42°C, I-Scel (induced by 0.1 mM IPTG) is to cleave the pDonor2.DepositorInsertsCas9
Gam, Beta, Exo
I-scel
Available SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Dest47- WTN23C11orf83-GFP
Plasmid#65845PurposeMammalian expression of the wild type N terminal part (N23, transmembrane part of 23 aa) of C11orf83/UQCC3 fused to GFP protein (C-ter)DepositorInsertTransmembrane (23 AA) of UQCC3 (UQCC3 Human)
TagsGFPExpressionMammalianMutationWT TransmembraneAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
FLAG-FLJ20309
Plasmid#15360DepositorAvailable SinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pET28b(+)-SPN+IFS
Plasmid#83372PurposeExpresses SPN and IFS complex in E. coli cellDepositorInsertsSPN
IFS
TagsHexahistidine tagExpressionBacterialPromoterT7Available SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-2-Ywhag-3'UTR-MRE-3 MUT
Plasmid#61792PurposeLuciferase reporter containing the 3'UTR of mouse Ywhag with MRE-3 mutatedDepositorInsertmouse Ywhag 3'UTR with miR-200c MRE-3 mutated
UseLuciferaseMutationmiR-200c MRE-3 mutatedAvailable SinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-RPLP15UTR-hRluc-A60
Plasmid#182639PurposeTranscription template plasmid for RPLP1 5'UTR followed by Renilla luciferase open reading frame and polyA sequenceDepositorInsertRenilla luciferase
UseLuciferaseExpressionMammalianMutationThe transcription is driven by a T7 promoter, pai…Available SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIG1_UL136_19kDa_EE
Plasmid#74951PurposePlasmid for mammalian expression of HCMV protein UL136. Expresses only the 19kda isoform of UL136. Also expresses EGFP.DepositorInsertUL136 (UL136 Human Cytomegalovirus strain TB40/E)
UseLentiviralTagsGlu-Glu tag (EYMPME)ExpressionMammalianMutationdelta 1-127PromoterCMV, lentiviral LTRAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCIG1_UL136_23kDa_Myc
Plasmid#74949PurposePlasmid for mammalian expression of HCMV protein UL136. Expresses only the 23kda isoform of UL136. Also expresses EGFP.DepositorInsertUL136 (UL136 Human Cytomegalovirus strain TB40/E)
UseLentiviralTagsHA Tag (YPYDVPDYA)ExpressionMammalianMutationdelta 1-99 M128APromoterCMV, Lentiviral LTRAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(WT)
Plasmid#112720PurposeWild-type TBP6.7 was one of the first evolved TAR-binding proteins to bind with exceptional affinity. It was this protein that was used to obtain co-crystals with WT TAR RNA.DepositorInsert6His-TEV-TBP6.7(WT)
Tags6His-TEVExpressionBacterialPromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(P46A)
Plasmid#112721PurposeThis mutation (P46A) marks the first residue within the evolved region of U1A.DepositorInsert6His-TEV-TBP6.7(P46A)
Tags6His-TEVExpressionBacterialMutationP46APromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(Q48T)
Plasmid#112725PurposeThis mutant of TBP6.7 binds to TAR very similarly to TBP6.7(WT), with only 1.4-fold reduced Kd.DepositorInsert6His-TEV-TBP6.7(Q48T)
Tags6His-TEVExpressionBacterialMutationQ48TPromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(P51A)
Plasmid#112728PurposeSimilar to P46, P51 was selected and is present in all evolved TBPs. Mutating this position into Ala has a modest effect on binding.DepositorInsert6His-TEV-TBP6.7(P51A)
Tags6His-TEVExpressionBacterialMutationP51APromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(Q54A)
Plasmid#112730PurposeAlthough not evolved, this residue within TBPs participates in stabilizing the polypeptide loop responsible for RNA recognition.DepositorInsert6His-TEV-TBP6.7(Q54A)
Tags6His-TEVExpressionBacterialMutationQ54APromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEMS1957
Plasmid#82568PurposeHigh copy number plasmid containing hs1218 MiniPromoter insert.DepositorInserthshs1218
UsePleiades promoter project [sic, pleaides plieades]Available SinceSept. 14, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1953
Plasmid#82567PurposeHigh copy number plasmid containing hs671 MiniPromoter insert.DepositorInserths671
UsePleiades promoter project [sic, pleaides plieades]Available SinceSept. 14, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCIG1_UL136_25kDa_Myc
Plasmid#74954PurposePlasmid for mammalian expression of HCMV protein UL136. Expresses only the 25kda isoform of UL136. Also expresses EGFP.DepositorInsertUL136 (UL136 Human Cytomegalovirus strain TB40/E)
UseLentiviralTags3xFLAG (GGGGDYKDDDDKGADYKDDDDKEFDYKDDDDK)ExpressionMammalianMutationdelta 1-77, M100A M128APromoterCMV, Lentiviral LTRAvailable SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only