We narrowed to 16,143 results for: crispr grnas
-
Plasmid#104045PurposeEncodes gRNA for 3' target of human ZNF511 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only
-
PX458_KLF11_1
Plasmid#86314PurposeEncodes gRNA for 3' target of human KLF11DepositorInsertgRNA against KLF11 (KLF11 Human)
UseCRISPRAvailable SinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KLF11_2
Plasmid#86315PurposeEncodes gRNA for 3' target of human KLF11DepositorInsertgRNA against KLF11 (KLF11 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJA46
Plasmid#59928PurposegRNA for cleavage at rde-1(D801) locus in C elegansDepositorInsertrde-1(D801) gRNA
UseCRISPRAvailable SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJA45
Plasmid#59927PurposegRNA for cleavage at rde-1(D718) locus in C elegansDepositorInsertrde-1(D718) gRNA
UseCRISPRPromoterU6Available SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE3-gRNA#2
Plasmid#107730PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE3-gRNA#1
Plasmid#107729PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJZC25
Plasmid#62328PurposesgRNA + 1x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
SunTag-FWAgRNA-4-14aa-TET1cd
Plasmid#106436PurposeSunTag CRISPR cas9 system that targets the TET1 catalytic domain to the FWA promoterDepositorInsertgRNA4_U6_NOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN414aa_OCS (TET1 Human, Mustard Weed, Synthetic)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-TdT-guide1-PGK-Puro
Plasmid#102903PurposeEBNA episome plasmid for U6 promoter-driven expression of a control gRNA targeting TdTomato sequence. Includes PGK-puro selection cassette.DepositorInsertTdT-guide1-PGK-Puro
UseCRISPRExpressionMammalianPromoterU6Available SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6-ACTA2_gRNA1-SpCas9-T2A-GFP
Plasmid#126706Purposeto express Cas9 from S. pyogenes with 2A-EGFP and sgRNA targeting human ACTA2 locus at the end of the endogenous coding sequenceDepositorInsertACTA2_gRNA1-SpCas9-T2A-GF (ACTA2 Human)
UseCRISPRAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUDE735
Plasmid#103024Purposeexpression of a Cpf1 programming crRNA targetting CAN1, HIS4, PDR12 and ADE2 (crCAN1-4.crHIS4-4.crPDR12-3.crADE2-3.S)DepositorInsertcrCAN1-4.crHIS4-4.crPDR12-3.crADE2-3.S
UseCRISPRExpressionYeastPromoterSNR52Available SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgRNA 1 GAPDH
Plasmid#83808PurposeExpress Sg-1 sgRNA targeting GAPDHDepositorInsertSgRNA
UseCRISPRAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSB700 HL1gR4
Plasmid#124450PurposeExpresses gRNA HL1 gR4 in the pSB700 backboneDepositorInsertHL1 gR4
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMH184
Plasmid#122857PurposeMS2-modified guide RNA targeting the FT promoter with GreenGate E-F flanking sequencesDepositorInsertMS2-modified sgRNA targeting the Arabidopsis FT promoter
UseGolden gate compatible cloning vectorAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330.iGFP3
Plasmid#66583PurposesgRNA for iGFPDepositorInsertiGFP
ExpressionMammalianAvailable SinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A3T
Plasmid#62260Purposeexpression of A3T sgRNA from the arabinose-inducible promoterDepositorInsertA3T sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A3NT
Plasmid#62259Purposeexpression of A3NT sgRNA from the arabinose-inducible promoterDepositorInsertA3NT sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A1T
Plasmid#62256Purposeexpression of A1T sgRNA from the arabinose-inducible promoterDepositorInsertA1T sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A4NT
Plasmid#62261Purposeexpression of A4NT sgRNA from the arabinose-inducible promoterDepositorInsertA4NT sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only