We narrowed to 262,954 results for: Gene

#129526

pDEF-SpCas9, No Target Control Vector for CRISPRi, PbEF1a promoter, 1st Generation

Scott Lindner

Walker et al J Biol Chem. 2019 Jun 14;294(24):9555-95

Sept. 10, 2019

Academic Institutions and Nonprofits only

#48651

Bacterial NM crRNA expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol

George Church

Esvelt et al Nat Methods. 2013 Sep 29. doi: 10.1038/n

Oct. 17, 2013

Academic Institutions and Nonprofits only

#54384

Martin Parniske

Binder et al PLoS One. 2014 Feb 13;9(2):e88218. doi:

July 22, 2014

Academic Institutions and Nonprofits only

#82022

an updated version of cLac94 (pACSA_PcptOO_YFP_PMB2__LacIWF). The homologous region upstream of the inducible system was fixed to add a stop codon for A1837. No difference in expression

Brian Pfleger

Markley et al ACS Synth Biol. 2015 May 15;4(5):595-603

Sept. 15, 2016

Academic Institutions and Nonprofits only

#35347

Jay Keasling

Lee et al J Biol Eng. 2011 Sep 20;5:12.

Feb. 20, 2012

Academic Institutions and Nonprofits only

#26881

Peter Kaiser

Tagwerker et al Yeast. 2006 Jun . 23(8):623-32.

Dec. 15, 2010

Academic Institutions and Nonprofits only

#133782

Expresses human codon-optimized intein-Cas9

Norbert Perrimon

Viswanatha et al Elife. 2018 Jul 27;7. pii: 36333. doi: 1

Jan. 31, 2020

Academic Institutions and Nonprofits only

#38147

Patricia Kuwabara

Soloviev et al Dev Biol. 2011 Mar 15;351(2):242-53. Epu

Oct. 25, 2012

Academic Institutions and Nonprofits only

#130937

Engineered sgRNA-LEA1 (2 BoxB aptamers) generator circuit including promoter Plux2

Baojun Wang

Liu et al Nat Commun. 2019 Aug 26;10(1):3693. doi:

Oct. 8, 2019

Academic Institutions and Nonprofits only

#54431

Martin Parniske

Binder et al PLoS One. 2014 Feb 13;9(2):e88218. doi:

Nov. 20, 2014

Academic Institutions and Nonprofits only