We narrowed to 26,192 results for: p
-
Plasmid#61344PurposemCherry fused to LINuS, a light-inducible nuclear localization signal (biNLS9/PKIt NES)DepositorInsertmCherry
TagsGS linker-AsLov2-biNLS9 and PKIt NESExpressionMammalianPromoterCMVAvailable SinceMay 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEF5/FRT/DEST-3xHA/mGli3/Flag P1-6A
Plasmid#51248PurposeEncodes N-3xHA-TEV-mouseGli3-Flag-C; amino acids 849,865,877,907,980,1006 mutated to AlaDepositorInsertGli3 (Gli3 Mouse)
UseFlpin systemTags3xHA-TEV and FlagExpressionMammalianMutationamino acids 849,865,877,907,980,1006 mutated to A…PromoterEF1aAvailable SinceMarch 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TB
Plasmid#48650PurposeBacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV10-mFoxP1-ES
Plasmid#35169DepositorAvailable SinceMarch 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pRK-ATF4 1-275
Plasmid#26118DepositorAvailable SinceMarch 1, 2011AvailabilityAcademic Institutions and Nonprofits only -
PGL4.11-COL1A1mSMAD
Plasmid#230917PurposeTested the COL1A1 promoter activity after abolition of the proximal SMAD binding sites in the promoter.DepositorInsertHuman COL1A1 promoter with mutant SMAD binding sequence (COL1A1 Human)
UseLuciferaseTagsLuciferase-luc2pExpressionBacterial and MammalianMutationCOL1A1 promoter with mutant potential SMAD bindin…PromoterCOL1A1Available SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-GSDMD-eGFP-SV40p-BlasR
Plasmid#228254PurposepLenti-CMV-GSDMD-eGFP-SV40p-BlasR plasmid for ectopic expression of human full-length GSDMD fusion with GFPDepositorAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
MSCV-ASNS-OE-IRES-Thy1.1
Plasmid#192947PurposeAsparagine synthetase overexpression in murine cellsDepositorAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDule-3-nitroTyrosine (A7)
Plasmid#174078PurposePlasmid for incorporating the non-canonical amino acid 3-nitroTyrosine with the third generation Mj 3NY (A7) synthetase and cognate amber suppressing tRNA in Ecoli.DepositorInsert3-nitroTyrosine tRNA synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
ExpressionBacterialMutationY32H H70T D158H I159A L162RPromoterGlnRS (constitutive)Available SinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pnEA-vH_His-TEV-SEPT2-msfGFP_SEPT6
Plasmid#174498Purposebacterial co-expression of human SEPT2 fused to monomeric superfolder GFP and of human SEPT6DepositorTagsHis6-TEV and msfGFPExpressionBacterialAvailable SinceSept. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Basic-Rab18-sfGFP(N) HDR template
Plasmid#129415PurposeHDR tempalte for tagging of endogenous human RAB18 N-terminus with sfGFPDepositorInsertRAB18 HDR template (RAB18 Human)
UseCRISPR and TALEN; Endogenous tagging hdr templateTagssfGFPExpressionMammalianAvailable SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
Dronpa-FHA1
Plasmid#87711PurposeEncodes N-terminal (PAABD) fragment of bimolecular super-resolution PKA activity reporter (bimFLINC-AKAR).DepositorInsertDronpa-FHA1
Tags6xHis, T7 tag (gene 10 leader), and Xpress (TM) t…ExpressionMammalianPromoterCMVAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pICE-HA-Ku70-siR-Mut6E
Plasmid#82330PurposePlasmid for constitutive or doxy-inducible expression of mutant human Ku70 unable to bind DNA and resistant to siRNA. Confers resistance to puro. Use T-REx cells for doxycycline-inducible expression.DepositorInsertKu70 (XRCC6 Human)
TagsHAExpressionMammalianMutationMut6E corresponding to K282E K287E T300E K331E K3…PromoterCMV-tetAvailable SinceSept. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
MIG-eIF4A1 P159E
Plasmid#70042PurposeExpression of eIF4A1 P159E mutant construct in mammalian cells.DepositorAvailable SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRSITEP-puro-shWRN2
Plasmid#125785PurposeDOX-inducible expression of a short-hairpin RNA targeting human WRNDepositorInsertshWRN2 (WRN Human)
UseRNAiAvailable SinceAug. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLXI_TRC401 LacZ
Plasmid#111183PurposeControl inducible vector with LacZ (V5 tagged)DepositorInsertlacZ
UseLentiviralTagsV5PromoterTREAvailable SinceMarch 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
T7_CC_Vpx-SIV_WPRE_IVT_Template
Plasmid#216792PurposeTemplate for in vitro transcription of Vpx (SIV).DepositorInsertVpx (SIV)
ExpressionMammalianPromoterT7Available SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEB2-2ndVal mCherry2-L
Plasmid#104027PurposePlasmid encoding 2ndVal mCherry2-LDepositorInsert2ndVal mCherry2-L
UseLow copyExpressionBacterialMutationmCherry2-L with valine inserted in 2nd positionPromoterproCAvailable SinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEB1-T-Sapphire
Plasmid#103977PurposePlasmid encoding T-SapphireDepositorInsertT-Sapphire
UseLow copyExpressionBacterialMutationMutations relative to wild-type GFP (Q69M, C70V, …PromoterproCAvailable SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-kanMX6-P3nmt1-3HA
Plasmid#39283DepositorInsertnmt1 promoter (nmt1 Fission Yeast)
UseYeast genomic targetingTags3xHA, A. gossypii translation elongation factor 1…Mutation-1163 to +6 of nmt1 locusAvailable SinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only