We narrowed to 10,300 results for: otos
-
Plasmid#242027PurposeA plasmid to generate a stably expressing preclonal mixture using puromycin selection.DepositorInsertCp PS Intein tTA Puro
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Split PS Intein gal4-vp16
Plasmid#242030PurposeBlue-light-controlled release of gal4-vp16 transactivator from the cytoplasm to the nucleus. Split version.DepositorInsertSplit PS Intein gal4-vp16
ExpressionMammalianMutationpNL3.2.NF-KB-RE[NlucP/NF-KB-RE/Hygro]PromoterCMVAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBIRC5-Split PS Intein-N tTA
Plasmid#242033PurposeN-terminal segment of the blue-light-controlled split PS Intein tTA gene expression system, co-expressing mTagBFP2 under the BIRC5 promoter.DepositorInsertSplit PS Intein-N tTA
TagsmTagBFP2ExpressionMammalianMutationThe CMV promoter was replaced with the BIRC5 prom…PromoterhTERTAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
phTERT-Split PS Intein-N tTA
Plasmid#242034PurposeN-terminal segment of the blue-light-controlled split PS Intein tTA gene expression system, co-expressing mTagBFP2 under the hTERT promoter.DepositorInsertSplit PS Intein-N tTA
TagsmTagBFP2ExpressionMammalianMutationThe CMV promoter was replaced with the hTERT prom…PromoterhTERTAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCherry-RILPL1 (R293A)
Plasmid#244981PurposeExpress RILPL1 in mammalian cells with mCherry tag expressing a R293A mutationDepositorAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-CIBN-p53CT(98-393)-mNeonGreen
Plasmid#241844PurposeExpresses a localizer of Opto-p53 in mammalian cells.DepositorInsertp53 (TP53 Human)
TagsCIBN and mNeonGreenExpressionMammalianMutationC-terminus (97-393 aa)PromoterCAGGS promoterAvailable SinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLG-mLRRC45 (158 a.a.)
Plasmid#240067PurposeITT reporter plasmid for cold and osmotic stressDepositorInsertLRRC45 C-terminal 158 a.a. (Lrrc45 Mouse)
UseRetroviralTagsLexA DNA-binding (DB) domain + Gal4 transactivati…ExpressionMammalianPromoterLTRAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLG-mLRRC45 (209 a.a.)
Plasmid#240068PurposeITT reporter plasmid for cold stressDepositorInsertLRRC45 C-terminal 209 a.a. (Lrrc45 Mouse)
UseRetroviralTagsLexA DNA-binding (DB) domain + Gal4 transactivati…ExpressionMammalianPromoterLTRAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLG-mCCDC91 (198 a.a.)
Plasmid#240069PurposeITT reporter plasmid for cold stressDepositorInsertCCDC91 C-terminal 198 a.a. (Ccdc91 Mouse)
UseRetroviralTagsLexA DNA-binding (DB) domain + Gal4 transactivati…ExpressionMammalianPromoterLTRAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCh-CRY2-sspB2
Plasmid#223691PurposePhoBIT2 component; sspB2 (sspB mutant A56F) fused to mCh-CRY2PHRDepositorAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV PHP.eB-CAG-Venus
Plasmid#233695PurposeAAV expression of Venus from CAG promoterDepositorInsertVenus
UseAAVExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSMPPv2-Tau-RING
Plasmid#233688PurposeExpression of Tau-RING protein in mammalian cellsDepositorInsertTau protein fused to TRIM21 RING domain
UseLentiviralExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYI2206
Plasmid#228348PurposeConstitutive rPhlTA mutant expressionDepositorInsertphlTA mutant
UseSynthetic BiologyTagsThree copies of VP16 (VP48)-Nuclear localization …ExpressionYeastMutationP5S, S6P, K86T, F109L, Q117R, E143KPromoterKpGAPDH promoterAvailable SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1026
Plasmid#228299PurposeConstitutive expression of PhlTA mutant with weak promoter and terminatorDepositorInsertphlTA mutant
UseSynthetic BiologyTagsThree copies of VP16 (VP48)-Nuclear localization …ExpressionYeastMutationE41GPromoterKpYPT1 promoterAvailable SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT478
Plasmid#228286PurposeConstitutive mutant rPhlTA expression with strong promoterDepositorInsertrphlTA mutant
UseSynthetic BiologyTagsThree copies of VP16 (VP48)-Nuclear localization …ExpressionYeastMutationP5S, S6P, K86T, F109L, Q117R, E143KPromoterKpGAPDH promoterAvailable SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only