We narrowed to 2,603 results for: pCas
-
Plasmid#172828PurposeMammalian expression of a sgRNA targeting the intron 1 position 4 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_VCL sgRNA / hSpCas9
Plasmid#172837PurposeMammalian expression of a sgRNA targeting the intron 21 (last intron) of VCL (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 21 of VCL under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_SpCas9_USP7 Exon 3 gRNA
Plasmid#131257PurposepX330-U6-Chimeric_BB-Cbh-hSpCas9 vector expressing a guide RNA targeting exon 3 of USP7DepositorInserthumanised S. pyogenes Cas9 nuclease
ExpressionMammalianAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX459V2.0-SpCas9-HF4
Plasmid#108295PurposepX459 V2.0 (Plasmid #62988) with the Y450A, N497A, R661A, Q695A, and Q926A mutationsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE1-gRNA#1
Plasmid#107726PurposeKnock out of EB1 in human cells by CRISPR/Cas9DepositorAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G2
Plasmid#86610PurposeExpresses the ATP1A1 G2 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 exon 4. Px330-like plasmidDepositorInsertATP1A1 G2 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via nhej using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable SinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti spCas9 T2A TagRFP-T P2A puro
Plasmid#122200PurposeThe plasmid codes for a Flag-spCas9 protein, a TagRFP-T fluorescent protein and a puromycin resistance. The plasmid has two BsmBI acceptor sites to insert gRNA expressing sequences.DepositorInsertsspCas9
TagRFP-T
UseLentiviralTagsT2AExpressionMammalianAvailable SinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-NRCH-ABE8e(V106W)
Plasmid#198556PurposeExpresses human codon-optimized SpCas9-NRCH-ABE8e(V106W) and blasticidin resistance: EFS promoter-SpCas9-NRCH-ABE8e(V106W)-NLS-FLAG-P2A-BSDDepositorInsertSpCas9-NRCH-ABE8e(V106W)
UseCRISPR and LentiviralTagsBSD, FLAG, and NLSExpressionMammalianPromoterEFSAvailable SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-SpCas9-HF1
Plasmid#201952PurposeMammalian expression plasmid of high-fidelity SpCas9 variant SpCas9-HF1 with T2A-EGFP and cloning backbone for sgRNADepositorInsertMammalian expression plasmid of high-fidelity SpCas9 variant SpCas9-HF1 with T2A-EGFP and cloning backbone for sgRNA
UseCRISPRTags3xHA, NLS, and T2A-EGFPExpressionMammalianPromoterCbhAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-tomato SOX2-sgRNA
Plasmid#196190PurposeEditing human SOX2 locusDepositorInsertSOX2 (SOX2 Human)
UseCRISPRAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSL103-SpCas9-FLAG-3XNLS
Plasmid#182032PurposeExpression of recombinant Streptococcus pyogenes Cas9 protein carrying C-terminal FLAG and 3XNLS for genome editing as Cas9 RNPDepositorInsertStreptococcus pyogenes cas9 (cas9 Synthetic)
UseCRISPRTags12X His tag, 3XNLS, FLAG, and MBPExpressionBacterialPromoterT7Available SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-NLC-DHFR-SpCas9
Plasmid#124523PurposeExpresses SpCas9 fused to DHFR domains on both the N- and C- termini and an internal loop in mammalian cellsDepositorInsertNLC-DHFR-SpCas9
UseAAVTagsDestabilized domain of E.coli dihydrofolate reduc…ExpressionMammalianPromoterCbhAvailable SinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKRG3-mU6-PUb-3xFLAG-hSpCas9
Plasmid#162161PurposeExpresses 3xFLAG tagged hSpCas9 (Ae. aegypti PUb promoter) with cloning site for sgRNAs (Ae. aegypti U6 promoter)DepositorInsertshSpCas9
sgRNA
UseCRISPRTags3xFLAGExpressionInsectPromoterAe. aegypti PUb and Ae. aegypti U6Available SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti spCas9 T2A iRFP670 P2A puro
Plasmid#122182PurposeThe plasmid codes for a Flag-spCas9 protein, a iRFP670 fluorescent protein and a puromycin resistance. The plasmid has two BsmBI acceptor sites to insert gRNA expressing sequences.DepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPV-TetO-SpCas9-GR-iC-ERiP (CRONUS-Puro)
Plasmid#100596PurposepiggyBac vector expressing Dual-regulated Cas9 (Puro resistance)DepositorInsertsCRISPR Cas9 fused with human Glucocorticoid Receptor
mCherry
rtTA-M2
UsePiggybac vectorExpressionMammalianMutationCodon-optimized for human codon usagePromoterDox-inducible TetO promoter and Human EEF1A1 prom…Available SinceApril 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCas3
Plasmid#229538PurposepMV_hyg encoding Cas3(wt) and crRNA expression cassette. Respective crRNA spacer can be introduced via BsmBI restriction cloning.DepositorInsertCas3
UseCRISPRExpressionBacterial and YeastMutationcodon optimized for S.cerevisiaeAvailable SinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas4_1_2_VA
Plasmid#186438PurposeEncodes Cas4, Cas1, Cas2, leader, repeat and one spacer from F. Novicida (type V-A)DepositorInsertCas4, Cas1 and Cas2
UseCRISPRPromoterT7Available SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCas12a
Plasmid#186446PurposeEncodes Cas12a from F. novicida (type V-A)DepositorInsertCas12a
UseCRISPRPromoterT7Available SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_mouse_Adar1_ccB
Plasmid#158122Purposedeletion mAdar1DepositorInsertAdar1 (Adar Mouse)
ExpressionMammalianAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only