We narrowed to 8,454 results for: gnal
-
Plasmid#108538PurposeExpresses human PCDH7 transcript variant a in mammalian cellsDepositorAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only
-
GFP(N-glyc)-Tac-TC
Plasmid#162496PurposeExpresses partial length Tac (TMD and cytosolic tail) with GFP tag in the N-terminus in mammalian cells, and there is one N-glycosylation site in GFP tag.DepositorInsertpartial length Tac (TMD and cytosolic tail) (IL2RA Human)
TagsGFPExpressionMammalianMutationTac is in partial length with its TMD and cysotol…Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHR FGFR1-CD3ε-FusionRed
Plasmid#188632PurposeHuman FGFR1 labeled with CD3ε ITAMs for monitoring with CD3ε/ZtSH2 pYtag biosensorDepositorInsertFGFR1 (FGFR1 Synthetic, Human)
UseLentiviralTagsCD3ε-FusionRedExpressionMammalianPromoterSFFVAvailable SinceAug. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
YFP-FKBP (YF)
Plasmid#20175DepositorInsertYFP-FKBP (YF): (FKBP1A Human)
ExpressionMammalianMutationFKBP was taken out from pC4M-F2E with a flanking …Available SinceMarch 24, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCWXPGR-pTF-dnTCF4
Plasmid#114277PurposeTET-inducible expression of a dominant negative form of the TCF4 transcription factorDepositorAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-mFzd7
Plasmid#102869PurposeExpresses mouse Fzd7 in mammalian cellsDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PB-U6-CNCB_sgEIF3D-4
Plasmid#236766PurposeA piggybac-based vector containing mouse U6 promoter-driven EIF3D sgRNA #4 and CAG promoter-driven nuclear-localized Clover-T2A-BSR.DepositorInsertEIF3D sgRNA-4 (EIF3D Human)
UsePiggybacExpressionMammalianPromotermouse U6 promoter and mouse U6 promoter, CAG prom…Available SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-SynTetOff-FLEX-[FGL-2A-palmRFP1]
Plasmid#190236PurposeAAV vector, high-level expression of somatodendritic-targeted EGFP (FGL) and membrane-targted mRFP1 (palmRFP1) in neuronal cells in the presence of Cre recombinaseDepositorInsertEGFP
UseAAVTagsF2A, LDLR C-terminal sequence, mRFP1, myristoylat…ExpressionMammalianAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLOC-MCOLN1
Plasmid#131583PurposeFor expression of human MCOLN1 in mammalian cells, GFP-taggedDepositorAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
LIMD1_pLX307
Plasmid#98349PurposeLentiviral expression of LIMD1DepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL3 1 kb prom. + Enhancer CD274
Plasmid#107005PurposeModified Luciferase expression vectorDepositorInsertCD274 (CD274 Human)
UseLuciferaseExpressionMammalianMutationN.B. There are two published SNPs in this region …Available SinceMarch 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
PH-Btk-mRuby2
Plasmid#124657PurposePI(3,4,5)P3 probe. PH domain of BTK fused with mRuby2DepositorInsertBTK (BTK Human)
TagsmRuby2ExpressionMammalianMutationcontains only the PH domain of Bruton tyrosine ki…Available SinceMay 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
mEos3.2FPP
Plasmid#203758PurposeEncodes the membrane anchor of HRas, including the last 10 residues of the C terminus with 1 farnesylation and 2 palmitoylations, with mEos3.2 fused to the N terminus. Used as a fluorescent plasma membrane probe.DepositorAvailable SinceJuly 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRepair-SGFP2-CTNNB1
Plasmid#153430PurposeHomology Directed Repair construct for N-terminal tagging of hsCTNNB1 with SGFP2DepositorInsertCTNNB1 homology arms and mTurquoise2 coding sequence (CTNNB1 Human)
UseCRISPR; Hdr donor templateTagsSGFP2Available SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX459-CTNNB1-ATG
Plasmid#153429PurposeExpresses a gRNA that overlaps the startcodon of human CTNNB1DepositorAvailable SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shMcu-1
Plasmid#181868PurposeExpresses Mcu-targeted shRNA under control of the U6 promoter and hrGFP under control of the synthetic CAG promoterDepositorInsertmitochondrial calcium uniporter (Mcu Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagshrGFPExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRetroX SgK269 WT
Plasmid#68028Purposeexpression of Sgk269 in mammalian cellsDepositorAvailable SinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCR3-FLAG-Gephyrin P1
Plasmid#68816PurposeFlag tagged Geph mammalian expressionDepositorInsertGephyrin (Gphn Rat)
Tags3xFLAGExpressionMammalianMutationsilent mutations on internal EcoRI site. Gephyrin…PromoterCMVAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Myc-HNF4A
Plasmid#219396PurposeExpress HNF4A in mammalian cellsDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only