We narrowed to 16,162 results for: grna
- 
  Plasmid#185550PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting FAM13ADepositorInsertFAM13A gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only - 
  
Lenti-N1303K-ngRNA+14_EF1a-puroR
Plasmid#207359PurposeLentiviral transfer plasmid encoding hU6-driven expression of a ngRNA for correction of N1303K-CFTR via prime editing and EF1a-driven puromycin resistance gene.DepositorInsertN1303K-CFTR +14 ngRNA
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only - 
  
Lenti-L227R-ngRNA+15_EF1a-puroR
Plasmid#207360PurposeLentiviral transfer plasmid encoding hU6-driven expression of a ngRNA for correction of L227R-CFTR via prime editing and EF1a-driven puromycin resistance gene.DepositorInsertL227R-CFTR +15 ngRNA
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only - 
  
pCF821-recipient_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211651PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertGuide RNA recipient vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only - 
  
pCF820-recipient_U6-sgRNA-EF1a-mCherry2
Plasmid#211647PurposeU6-sgRNA-EF1a-mCherry2DepositorInsertGuide RNA recipient vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only - 
  
Lenti-sgRNA-Cre-GpNLuc-sgmATM
Plasmid#208392PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ATM gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only - 
  
Lenti-sgRNA-Cre-GpNLuc-sgmMRE11
Plasmid#208384PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine MRE11 gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only - 
  
Lenti-sgRNA-Cre-GpNLuc-sgmZBP1#3
Plasmid#208389PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ZBP1#3 gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only - 
  
Lenti-sgRNA-Cre-GpNLuc-sgmMLKL
Plasmid#208391PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine MLKL gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only - 
  
pMMK ENTR 2 hU6 ACTB sgRNA
Plasmid#206270PurposeENTR Vector 2 for MultiSite Gateway assembly. Encodes hU6 hACTB sgRNADepositorInsertACTB sgRNA
UseCRISPR; Multimate/gateway entr 2ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only - 
  
pMMK ENTR 2 hU6 HEK3 PegRNA
Plasmid#206277PurposeENTR Vector 2 for MultiSite Gateway assembly. Encodes HEK3 PegRNADepositorInsertHEK3 PegRNA
UseCRISPR; Multimate/gateway entr 2ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only - 
  
lentiCRISPRv2-sgRNAs-del-ZNF91-BFP
Plasmid#202823PurposeLentiviral vector modified to express two sgRNAs that delete exon 1 within the ZNF91 gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete exon 1 within ZNF91 gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only - 
  
pCA23-sgRNA vector-U6-sgTS2 (SpCas9)
Plasmid#199454PurposeU6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC)DepositorInsertTS2 sgRNA
UseCRISPRPromotermouse U6Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only - 
  
pAAV-U6-sgRNA(OXTR.2)-CMV-eGFP
Plasmid#194016PurposeExpresses a gRNA that targets OXTR coding sequence in multiple (rodent) species and eGFPDepositorInsertssgRNA(Oxtr.2)
eGFP
UseAAV and CRISPRExpressionMammalianPromotercmb and u6Available SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only - 
  
CAGGS-AsCpf1-2A-GFP-U6-tdTomato-sgRNA
Plasmid#194724Purposebased on (CAGGS-AsCpf1-2A-GFP-U6-sgRNA-cloning vector, Addgene 159281), with guide RNA that target tdTomatoDepositorArticleInsertAsCpf1
UseCRISPRExpressionMammalianAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only - 
  
RPS4X sgRNA-3 lentiCRISPR v2-Blast plasmid
Plasmid#192233Purposelentiviral vector expressing sgRNA-3 targeting eIF3 binding site of RPS4X 5'UTRDepositorInsertsgRNA-3 targeting eIF3 binding site of RPS4X 5'UTR (RPS4X Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only - 
  
RPS15A sgRNA-5 lentiCRISPR v2-Blast plasmid
Plasmid#192230Purposelentiviral vector expressing sgRNA-5 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-5 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only - 
  
RPS4X sgRNA-4 lentiCRISPR v2-Blast plasmid
Plasmid#192234Purposelentiviral vector expressing sgRNA-4 targeting eIF3 binding site of RPS4X 5'UTRDepositorInsertsgRNA-4 targeting eIF3 binding site of RPS4X 5'UTR (RPS4X Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only - 
  
RPS15A sgRNA-4 lentiCRISPR v2-Blast plasmid
Plasmid#192229Purposelentiviral vector expressing sgRNA-4 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-4 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only - 
  
LentiU6-hIL1RN gRNA_1-MS2-Puro
Plasmid#192677PurposeLentiviral expression of sgRNA targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNA #1 (IL1RN Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only