We narrowed to 23,338 results for: Nov;
-
Plasmid#127499PurposeExpresses myc-tagged NDUFS2/H60A in mammalian cellsDepositorInsertNDUFS2 H60A (NDUFS2 Human)
UseTagsmyc-HisExpressionMammalianMutationNDUFS2 H60APromoterCMVAvailable sinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/NDUFS2 W61A/myc-His
Plasmid#127500PurposeExpresses myc-tagged NDUFS2/W61A in mammalian cellsDepositorInsertNDUFS2 W61A (NDUFS2 Human)
UseTagsmyc-HisExpressionMammalianMutationNDUFS2 W61APromoterCMVAvailable sinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/NDUFS2 K62A/myc-His
Plasmid#127501PurposeExpresses myc-tagged NDUFS2/K62A in mammalian cellsDepositorInsertNDUFS2 K62A (NDUFS2 Human)
UseTagsmyc-HisExpressionMammalianMutationNDUFS2 K62APromoterCMVAvailable sinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/NDUFS2 P63A/myc-His
Plasmid#127502PurposeExpresses myc-tagged NDUFS2/P63A in mammalian cellsDepositorInsertNDUFS2 P63A (NDUFS2 Human)
UseTagsmyc-HisExpressionMammalianMutationNDUFS2 P63APromoterCMVAvailable sinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28B-PU.1-ETS-Wing
Plasmid#124552PurposeChimeric ETS domain: Wing of Ets-1 in PU.1 scaffoldDepositorUseTags6xHis tagExpressionBacterialMutationThe 5 residues making up the "wing" in …PromoterAvailable sinceJune 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28B-PU.1-ETS-H3/S3
Plasmid#124627PurposeChimeric ETS domain: H3/S3 of Ets-1 in PU.1 scaffoldDepositorUseTags6xHis tagExpressionBacterialMutationResidues 237 to 241 replaced with corresponding s…PromoterAvailable sinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2delta
Plasmid#124154PurposeProtein expression for funtional studies of cell growth promotionDepositorInsertYAP1 (YAP1 Human)
UseUnspecifiedTagsExpressionMutationNone (Wild Type)PromoterAvailable sinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) mEOS2 hYAP 1-1alpha
Plasmid#124155PurposeProtein expression for funtional studies of cell growth promotionDepositorInsertmEOS2-YAP1 (YAP1 Human)
UseUnspecifiedTagsExpressionMutationNone (Wild Type)PromoterAvailable sinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro)mEOS2 hYAP 1-1gamma
Plasmid#124157PurposeProtein expression for funtional studies of cell growth promotionDepositorInsertmEOS2-YAP1 (YAP1 Human)
UseUnspecifiedTagsExpressionMutationNone (Wild Type)PromoterAvailable sinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) mEOS2 hYAP 1-1delta
Plasmid#124158PurposeProtein expression for funtional studies of cell growth promotionDepositorInsertmEOS2-YAP1 (YAP1 Human)
UseUnspecifiedTagsExpressionMutationNone (Wild Type)PromoterAvailable sinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) mEOS2 hYAP 1-2alpha
Plasmid#124159PurposeProtein expression for funtional studies of cell growth promotionDepositorInsertmEOS2-YAP1 (YAP1 Human)
UseUnspecifiedTagsExpressionMutationNone (Wild Type)PromoterAvailable sinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) mEOS2 hYAP 1-2beta
Plasmid#124160PurposeProtein expression for funtional studies of cell growth promotionDepositorInsertmEOS2-YAP1 (YAP1 Human)
UseUnspecifiedTagsExpressionMutationNone (Wild Type)PromoterAvailable sinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) mEOS2 hYAP 1-2gamma
Plasmid#124161PurposeProtein expression for funtional studies of cell growth promotionDepositorInsertmEOS2-YAP1 (YAP1 Human)
UseUnspecifiedTagsExpressionMutationNone (Wild Type)PromoterAvailable sinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1alpha
Plasmid#124147PurposeProtein expression for funtional studies of cell growth promotionDepositorInsertYAP1 (YAP1 Human)
UseUnspecifiedTagsExpressionMutationNone (Wild Type)PromoterAvailable sinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1beta
Plasmid#124148PurposeProtein expression for funtional studies of cell growth promotionDepositorInsertYAP1 (YAP1 Human)
UseUnspecifiedTagsExpressionMutationNone (Wild Type)PromoterAvailable sinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1gamma
Plasmid#124149PurposeProtein expression for funtional studies of cell growth promotionDepositorInsertYAP1 (YAP1 Human)
UseUnspecifiedTagsExpressionMutationNone (Wild Type)PromoterAvailable sinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2alpha
Plasmid#124151PurposeProtein expression for funtional studies of cell growth promotionDepositorInsertYAP1 (YAP1 Human)
UseUnspecifiedTagsExpressionMutationNone (Wild Type)PromoterAvailable sinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2beta
Plasmid#124152PurposeProtein expression for funtional studies of cell growth promotionDepositorInsertYAP1 (YAP1 Human)
UseUnspecifiedTagsExpressionMutationNone (Wild Type)PromoterAvailable sinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2gamma
Plasmid#124153PurposeProtein expression for funtional studies of cell growth promotionDepositorInsertYAP1 (YAP1 Human)
UseUnspecifiedTagsExpressionMutationNone (Wild Type)PromoterAvailable sinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) mEOS2 hYAP 1-1beta
Plasmid#124156PurposeProtein expression for funtional studies of cell growth promotionDepositorInsertmEOS2-YAP1 (YAP1 Human)
UseUnspecifiedTagsExpressionMutationNone (Wild Type)PromoterAvailable sinceApril 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 (-) hYAP 1-1beta
Plasmid#124140PurposeProtein expression for funtional studies of cell growth promotionDepositorInsertYAP1 (YAP1 Human)
UseUnspecifiedTagsExpressionMutationNone (Wild Type)PromoterAvailable sinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP324-pAAV-FullH1TO-SaCa9sgRNAi(emx1sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113701PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHExpressionMutationPromoterAvailable sinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP322-pAAV-FullU6TO-SaCa9sgRNAi(emx1-sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113699PurposeDox-inducible U6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHExpressionMutationPromoterAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-PARK6e5-I368N
Plasmid#86154PurposeDonor plasmid for PARK6 exon5 I368N sequence. Also contains TagBFP and dTomatoDepositorInsertPINK1 exon 5 homology arms (PINK1 Human)
UseTagsExpressionBacterial and MammalianMutationPromoterAvailable sinceJune 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAP1893-1
Plasmid#105248Purposehuman GFP11 with tagRFP 33bp downstream in Lamin A/C (recoded)DepositorInsertInsertion of GFP11 at cut tagRFP 33bp downstream (recoded *) in Lamin A/C (LMNA Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV2_hSyn_Aurora_CA_Citrine
Plasmid#98219PurposeSlow cycling (open for minutes) step-function artificial anion conducting channelrhodopsin (aACR). High light sensitivity. Activation with green light, inactivation max with 625 nm (accelarates closure to ms). Not recommended for in vivo use. Codon optimized for mammalian expression.DepositorInsertSynthetic construct Aurora_C128A gene
UseAAVTagsCitrineExpressionMammalianMutationV59S, E83N, E90Q, E101S, V117R, E123S, C128A, P24…Promoterhuman synapsinAvailable sinceAug. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 E2F1 Flag(Δ193-359) (HindIII- BamHI- EcoRI)
Plasmid#70667PurposeHuman mutant of E2F1 lacking amino acids 193-359DepositorInsertE2F1 lacking residues 193 to 359 (E2F1 Human)
UseTagsFLAGExpressionMammalianMutationlacks amino acids 193-359PromotercmvAvailable sinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only