We narrowed to 7,272 results for: mag
-
Plasmid#213036PurposeThis vector contains rTTA expressed under CMV promoter and gRNA expressed under U6 promoterDepositorInsertrTTA-T2A-mCherry
UseAAV and CRISPRPromoterCMVAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
p3E mCherry-T2A-hsHRAS-G12V-pA (JDW 1188)
Plasmid#242571PurposeGateway 3' entry clone containing mCherry followed by a T2A cleavage peptide and then human HRAS G12V.DepositorInsertHRAS-G12V (HRAS Human)
UseGateway subcloningAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2-Sun1-2xsfGFP-6xMYC-pA (JDW 694)
Plasmid#242588PurposeA CMV driven expression vector containing a Sun1-2xsfGFP for labeling nuclear envenlope.DepositorAvailable SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLK06Hpp-Fab CR3009
Plasmid#239861PurposePlasmid for simultaneous Fab and GFP expression from separate Lac promoters for online monitoring of induction with a GFP sensor station. Fab is expressed as a fusion with alkaline phosphatase.DepositorInsertsTagsHexahistidine tag and bacterial alkaline phosphat…ExpressionBacterialMutationF64L, S65T, Q80R, M153T and V163APromoterLac promoterAvailable SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-FLEX(cre)-OCaMP-WPRE
Plasmid#229853PurposepAAV vector for Cre-dependent OCaMP (orange calcium indicator) expression under the control of hSyn promoterDepositorInsertOCaMP
UseAAVTags6xHisExpressionMammalianAvailable SinceAug. 25, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pME-V5-mTagBFP2-KRAS4A-WT (JDW 831)
Plasmid#242568PurposeGateway middle entry clone containing an mTagBFP2 fused human KRAS4A WT.DepositorInsertKRAS4A (WT) (KRAS Human)
UseGateway subcloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-V5-mClover-KRAS4A-WT (JDW 812)
Plasmid#242566PurposeGateway middle entry clone containing an mClover3 fused human KRAS4A WT.DepositorInsertKRAS4A (WT) (KRAS Human)
UseGateway subcloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-NES-SomaFRCaMPi
Plasmid#232836PurposeAAV transfer plasmid for CAG-mediated Cre-dependent expression of soma-targeted FRCaMPiDepositorAvailable SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-NES-SomaKGECO1
Plasmid#232839PurposeAAV transfer plasmid for Syn-mediated expression of soma-targeted KGECO1DepositorAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NES-FRCaMPi-P2A-mGreenLantern
Plasmid#232841PurposeAAV transfer plasmid for CAG-mediated co-expression of FRCaMPi and mGreenLanternDepositorAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NES-KGECO1-P2A-mGreenLantern
Plasmid#232843PurposeAAV transfer plasmid for CAG-mediated co-expression of KGECO1 and mGreenLanternDepositorAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NES-jRGECO1-P2A-mGreenLantern
Plasmid#232844PurposeAAV transfer plasmid for CAG-mediated co-expression of jRGECO1 and mGreenLanternDepositorAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-FLEX(FLP)-OCaMP-WPRE
Plasmid#224936PurposepAAV vector for flippase(FLP)-dependent OCaMP (orange calcium indicator) expression under the control of EF1a promoterDepositorInsertOCaMP
UseAAVTags6xHisExpressionMammalianPromoterEf1aAvailable SinceJuly 28, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-Syn-NES-SomajRGECO1a
Plasmid#232842PurposeAAV transfer plasmid for Syn-mediated expression of soma-targeted jRGECO1aDepositorAvailable SinceJune 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-NONO-TFE3
Plasmid#237641PurposeFor overexpression of mEGFP-NONO-TFE3DepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-CRTC1-MAML2-KS
Plasmid#237672PurposeFor overexpression of mEGFP-CRTC1-MAML2-KSDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-YAP-MAMLD1-KS
Plasmid#237676PurposeFor overexpression of mEGFP-YAP-MAMLD1-KSDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-NONO-TFE3-KS
Plasmid#237681PurposeFor overexpression of mEGFP-NONO-TFE3-KSDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only