We narrowed to 36,311 results for: lat
-
Plasmid#119913PurposeMammalian expression of the tAKARα sensor for detecting PKA activity using two-photon fluorescence lifetime imaging microscopy (2pFLIM)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserttAKARα
ExpressionMammalianAvailable sinceMarch 9, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pgRGFP
Plasmid#82695PurposeExpresses gRNA of interest under U6 promoter (cloning by BpiI) and GFP under PGK promoter.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterPGK, U6Available sinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
GFP-CLCb (EED/QQN)
Plasmid#47422DepositorInsertCLCb EED/QQN (CLTB Human)
TagsEGFPExpressionMammalianMutationEED changed to QQN, in aa20-41 regionPromoterCMVAvailable sinceJuly 29, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pET22b-ecDHFR
Plasmid#109055PurposeBacterial expression of E.coli DHFR proteinDepositorInsertecDHFR
ExpressionBacterialPromoterT7Available sinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pdCas9-DNMT3A-PuroR_BACH2-sgRNA8
Plasmid#71828PurposeExpression of dCas9-DNMT3A fusion with T2A-PuroR and specific sgRNA for targeted DNA methylation of BACH2 promoter in human cells; for use as a controlDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertBACH2-sgRNA8 (BACH2 Human, Synthetic, S. pyogenes)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-PuroRExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9PromoterU6Available sinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2/DEST/hCx43-E2HA-stop
Plasmid#40909DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertConnexin 43 internal HA tag (GJA1 Human)
ExpressionMammalianMutationHA tag inserted in second extracellular loopPromoterCMVAvailable sinceNov. 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
pFH2.9_MMLV_Gag-P2A-eGFP
Plasmid#205524PurposeExpress MMLV Gag-P2A-eGFPDepositorInsertGag
ExpressionMammalianMutationWTPromoterCMVAvailable sinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAd5-B6/7 ∆E3-GFP
Plasmid#179202PurposeA block for the AdenoBuilder genome assembly system. The insert consolidates the regions present in pAd5-B6∆E3-GFP and pAd5-B7.DepositorInsertModified block 6/7, with deletion in E3 and insertion of GFP cassette
UseAdenoviralAvailable sinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
GreenT-EC - Display - CyRFP1
Plasmid#193943PurposeMammalian expression vector for a low affinity calcium indicator exposed to the cell surfaceDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGreenT-EC
TagsIgk_secretion - HA-Flag and PDGFRExpressionMammalianAvailable sinceSept. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRham-CALM1
Plasmid#182500PurposeBacterial expression of the Homo sapiens calmodulin, CALM1DepositorAvailable sinceMay 11, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcU6_1 sgRNA
Plasmid#92395PurposeChicken-specific U6 sgRNA expression mini-vector, harbouring chick U6_1 pol III promoter.DepositorInsertchick U6.1 promoter and gRNA cloning cassette
UseCRISPRExpressionMammalianPromoterchick U6.1Available sinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
NpT7-5-ERK1
Plasmid#39229DepositorAvailable sinceJuly 15, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AzoRS-4
Plasmid#182884PurposeA pEvol-based plasmid containing one inducible (by arabinose) copy of the AzoRS-4 aaRS. The 2nd constitutive aaRS copy typically found in pEvol plasmids was deleted.DepositorInsertAzoRS-4
ExpressionBacterialAvailable sinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMaCTag-Z23
Plasmid#120066PurposeTemplate for C-terminal PCR tagging of mammalian genes (Zeocin selection) with HaloDepositorInsertHalo
UsePcr templateTagsHaloPromoterNoneAvailable sinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGME
Plasmid#71252Purposeluciferase reporter with GM-CSF promoter + 717 bp Bgl II GM-CSF enhancerDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGM-CSF enhancer (CSF2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianPromoterGM-CSFAvailable sinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDB4283
Plasmid#98702PurposeA plasmid containing the 3' portion of the bsdMX marker and the gRNA elements downstream of the target sequence. It serves as the PCR template for generating the gRNA insert in the split-bsdMX systemDepositorInsertgRNA PCR template
UseCRISPRExpressionYeastAvailable sinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TB
Plasmid#48650PurposeBacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertBacterial SP crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable sinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDONR207 SARS-CoV-2 ORF7A_nostop
Plasmid#149324PurposeGateway-compatible Entry vector, with insert of ORF7A gene's CDS from SARS-CoV-2 isolate Wuhan-Hu-1. Does not contain stop codon.DepositorInsertORF7A (ORF7a SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway CloningMutationMany synonymous changes due to codon optimizationAvailable sinceMay 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV hSyn GFP-Fxr1
Plasmid#112732PurposeAAV plasmid that expresses GFP-Fxr1 fusion protein under hSYN promoterDepositorAvailable sinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shETV4-A
Plasmid#74975PurposeshETV4 shRNADepositorAvailable sinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only