We narrowed to 6,947 results for: KIT;
-
Plasmid#172415PurposeMAC-tagged gene expressionDepositorAvailable SinceNov. 4, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pDONR P4-P1R-EGFP
Plasmid#48348PurposeContributes the coding sequence for EGFP as the 5’-module during MultiSite Gateway-cloning of chimeric cDNAs encoding three-part fusion proteins.DepositorInsertEGFP
UseGateway entry vectorMutationContains a Kozak sequence. Does not contain a sto…PromoternoneAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS4-dTom
Plasmid#178718PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of dTom in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertdTom
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBUN6A11
Plasmid#50579PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-VP64, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInsertsdCas9-VP64
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 = defective in DNA cleavage; 4×minimal VP16…PromoterOsU3p and Ubi1pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-FLEX(frt)-GCaMP6f-WPRE
Plasmid#118273PurposepAAV vector for flippase dependent GCaMP6f expression under the control of EF1a promoterDepositorInsertGCaMP6f
UseAAVTags6xHis (N terminal on insert), T7 epitope, and Xpr…ExpressionMammalianPromoterEF1aAvailable SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET32a-hHBEGF
Plasmid#199234PurposeBacterial production of soluble, active target proteins; Nterm thrombin and enterokinase cleavage sites.DepositorInsertProheparin-binding EGF-like growth factor (HBEGF Human)
TagsTrxA-6xHis-S-tagExpressionBacterialPromoterT7Available SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBUN6I11
Plasmid#50580PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-KRAB, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInsertsdCas9-KRAB
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 that is defective in DNA cleavage; the maiz…PromoterOsU3p and Ubi1pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJW2171
Plasmid#163095PurposeCRISPR repair template: add insertion site specific homology arms by PCR before insertionDepositorInsert30aa linker::mNeonGreen (dpi)::AID*::3xFLAG::10aa linker
UseCRISPRExpressionWormMutationSilent mutations to remove piRNA sitesAvailable SinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFUW-TetO-Fos
Plasmid#131593Purposedoxycycline-inducible expression of mouse c-Fos in mammalian cellsDepositorAvailable SinceDec. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJW2086
Plasmid#154335PurposeCrispr repair template: add insertion site specific homology arms by PCR before insertionDepositorInsert30aa linker::GFP::AID*::3xFLAG::10aa linker
UseCRISPRExpressionWormAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS1-hChR2-tBFP
Plasmid#178706PurposeAAV vector for transgene expression of hChR2-tBFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInserthChR2-tBFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOD1988-epiDEG
Plasmid#89357PurposeMosSCI targeting vector expressing a fusion between a GFP nanobody and an ubiquitin ligase adaptor ZIF-1 to degrade GFP tagged proteins. Expression is controlled by Pdpy-7 (epidermis specific).DepositorInsertvhhGFP4-ZIF-1 (zif-1 Nematode, Synthetic)
UseTargeting vector for mos1 transposon mediated sin…TagsvhhGFP4 (GFP nanobody)PromoterPdpy-7Available SinceJune 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
CMVp-dCas9-3xNLS-VP64 (Construct 1)
Plasmid#55195PurposeExpresses taCas9 in Mammalian cells for transactivating endogenous and synthetic promoters. The backbone is a lentiviral vector.DepositorInsertdCas9
UseCRISPR and Synthetic BiologyTagsVP64ExpressionMammalianPromoterCMV/hUBCAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJW2172
Plasmid#163096PurposeCRISPR repair template: add insertion site specific homology arms by PCR before insertionDepositorInsert30aa linker::mNeonGreen (dpi)::3xFLAG::10aa linker
UseCRISPRExpressionWormMutationSilent mutations to remove piRNA sitesAvailable SinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS4
Plasmid#170855PurposeAAV backbone for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of any transgene in neurons under the control of the hSyn1 promoter.DepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-REX-GECO1
Plasmid#61248PurposeExpresses REX-GECO1 in neuronsDepositorInsertREX-GECO1
UseAAVExpressionMammalianMutationSubstitutions relative to R-GECO1: P60R, V61W, R6…PromoterhSynAvailable SinceMarch 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJW1821
Plasmid#163092PurposeCRISPR repair template: add insertion site specific homology arms by PCR before insertionDepositorInsertmScarlet^SEC (Lox511I)^::3xMyc
UseCRISPR and Cre/LoxExpressionWormAvailable SinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-short_BrokenHeart (no BC)
Plasmid#86950PurposeAAV transfer plasmid containing the BrokenHeart construct: a hyperpiggybac donor transposon interrupting the tdTomato fluorophore. Transposase activity rescues coding sequence.DepositorInsertBrokenheart construct
UseAAVExpressionMammalianAvailable SinceApril 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only