We narrowed to 20,022 results for: aga
-
Plasmid#103020Purposeexpression of a Cpf1 programming crRNA targeting ADE2 and HIS4 (crADE2-3 crHIS4-4.S)DepositorUseCRISPRTagsExpressionYeastMutationPromoterSNR52Available sinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only
-
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_1
Plasmid#155065PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCR3-FLAG-Gephyrin G
Plasmid#68817PurposeGeph G domain expression in mamalian cellsDepositorInsertGephyrin (Gphn Rat)
UseTags3xFLAGExpressionMammalianMutationNILPromoterCMVAvailable sinceAug. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRRL-mouse cGAS #2-gRNA-Cas9-Puro
Plasmid#186891PurposegRNA targeting mouse cGAS (with Cas9 insert)DepositorInsertCas9 (Cgas Mouse)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK alfa mouse
Plasmid#224576PurposeNegative Control for downregulation of the expression of human DGK alfa in human cellsDepositorInsertsh RNAi Diacylglycerol kinase alfa mouse (Dgka Mouse)
UseRNAi and RetroviralTagsExpressionMutationPromoterH1Available sinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-CAPRIN1-ts1
Plasmid#174229PurposeCAPRIN1 knockdownDepositorInsertCAPRIN1 shRNA (CAPRIN1 Human)
UseLentiviral and RNAiTagsExpressionMutationPromoterSFFVAvailable sinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(VENTX_5-5)-PGKpuroBFP-W
Plasmid#211993PurposeExpress gRNA against VENTX with puro and BFPDepositorInsertsgRNA targeting VENTX (VENTX Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Teton-puro-shFDPS #2
Plasmid#198760Purposeconditional knockdown of FDPSDepositorInsertshFDPS #2 (FDPS Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
PX459_GRHL1-exon5
Plasmid#177763PurposesgRNA for CRISPR/Cas9-mediated deletion of human GRHL1DepositorInsertGRHL1 (GRHL1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_gRNA_H19-DMR-1
Plasmid#159929PurposeSpecific gRNA against mouse H19-DMR cloned in the pX330 backbone (Addgene Number 42230). Deletion of H19-DMR in mouse ESC.DepositorInsertgRNA mouse H19-DMR (H19-icr Mouse)
UseCRISPR and Mouse TargetingTagsExpressionMammalianMutationPromoterU6, CBhAvailable sinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_4
Plasmid#155076PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_4
Plasmid#155068PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
TLK2 gRNA (BRDN0001147939)
Plasmid#75617Purpose3rd generation lentiviral gRNA plasmid targeting human TLK2DepositorInsertTLK2 (TLK2 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_5
Plasmid#155063PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV CAG Barcode2
Plasmid#229063PurposeExpression mappingDepositorInsertCAG Barcode2
UseAAVTagsExpressionMutationPromoterAvailable sinceDec. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAcGFP1-N1-Dsup
Plasmid#90020PurposeTo express GFP-tagged Dsup in mammalian cells transientlyDepositorInsertDsup
UseTagsAcGFP1ExpressionMammalianMutationPromoterCMVAvailable sinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
EGFPC2-Gephyrin P1
Plasmid#68815Purposeexpression of fluorescent tagged Geph in mammalian cellsDepositorInsertGephyrin (Gphn Rat)
UseTagsEGFPExpressionMammalianMutationsilent mutations on internal EcoRI site. Gephyri…PromoterCMVAvailable sinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCR3-FLAG-Gephyrin P1
Plasmid#68816PurposeFlag tagged Geph mammalian expressionDepositorInsertGephyrin (Gphn Rat)
UseTags3xFLAGExpressionMammalianMutationsilent mutations on internal EcoRI site. Gephyrin…PromoterCMVAvailable sinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (GAPDH)
Plasmid#170120PurposeAAV vector carrying a guide RNA targeting the human GAPDH mRNADepositorInsertCircular 200,100 guide RNA (GAPDH Human)
UseAAVTagsExpressionMammalianMutationPromoterHuman U6Available sinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAcGFP1-N1-Dsup-C
Plasmid#90022PurposeTo express GFP-tagged C-terminal region of Dsup in mammalian cells transientlyDepositorInsertDsup
UseTagsAcGFP1ExpressionMammalianMutationC-terminal region alonePromoterCMVAvailable sinceMay 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCJ207
Plasmid#162680PurposepET-21b(+) based plasmid for expression of the putative MHETase from Hydrogenophaga sp. PML113 (Genbank WP_083293388.1) with C-terminal His tag, codon optimized for expression in E. coli K12.DepositorInsertPutative MHETase from Hydrogenophaga sp. PML113 (Genbank WP_083293388.1) with signal peptide
UseTagsHisExpressionBacterialMutationcodon optimized for expression in E. coli K12PromoterT7/lacAvailable sinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
CDKN1A (p21) targeting gRNA
Plasmid#215319PurposeExpresses gRNA targeting CDKN1A (p21) and pSpCas9(BB)-2A-GFP in mammalian cells from the px458 vector.DepositorInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianMutationPromoterCbhAvailable sinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFPC2-gephyrin S268A/270A
Plasmid#199608PurposeEncodes N-terminal eGFP-tagged P1-gephyrin S268/270A for expression in mammalian cells.DepositorInsertGephyrin (Gphn Rat)
UseTagsEGFPExpressionMammalianMutationS268A/S270APromoterCMVAvailable sinceMay 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCR3-FLAG-Gephyrin E
Plasmid#68819PurposeFlag tagged mammalian expression of E domainDepositorInsertGephyrin (Gphn Rat)
UseTags3xFLAGExpressionMammalianMutationinternal EcoRI site has silent mutationPromoterCMVAvailable sinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUDP044
Plasmid#101168PurposepUDP004 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes SeATF1 and SeATF2 and Spcas9D147Y P411T in S. pastorianus (HH-gRNASeATF1-HDV-linker-HH-gRNASeATF2-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting SeATF1 and 2 in S. pastorianus
UseCRISPRTagsExpressionYeastMutationPromoterScTDH3Available sinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK alfa human
Plasmid#224578PurposeTo stably downregulate the expression of human DGK alfa in human cellsDepositorInsertsh RNAi Diacylglycerol kinase alfa human (DGKA Human)
UseRNAi and RetroviralTagsExpressionMutationPromoterH1Available sinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RUNX1T1 g7-5)-PGKpuroBFP-W
Plasmid#211985PurposeExpress gRNA against RUNX1T1 with puro and BFPDepositorInsertsgRNA targeting RUNX1T1 (RUNX1T1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(PDLIM1_Bru)-PGKpuroBFP-W
Plasmid#211979PurposeExpress gRNA against PDLIM1 with puro and BFPDepositorInsertsgRNA targeting PDLIM1 (PDLIM1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFPC2-gephyrin S268E/270E
Plasmid#199609PurposeEncodes N-terminal eGFP-tagged P1-gephyrin S268/270E for expression in mammalian cells.DepositorInsertGephyrin (Gphn Rat)
UseTagsEGFPExpressionMammalianMutationS268E/S270EPromoterCMVAvailable sinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only