We narrowed to 16,652 results for: grn
-
Plasmid#103873PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Ogataea (para)polymorphaDepositorInsertHH-gRNA-HDV targetting ADE2 in Ogataea (para)polymorpha
UseCRISPRExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCJ1022
Plasmid#228762PurposePlasmid expressing Cas9 and 2 gRNAs for mouse Pkd2. Use for disruption of mouse Pkd2 in cultured cells.DepositorAvailable SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCJ1021
Plasmid#228761PurposePlasmid expressing Cas9 and 2 gRNAs for mouse Ift88. Use for disruption of mouse Ift88 in cultured cells.DepositorAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAH750
Plasmid#91212Purposeprotoplast vector expressing 2 gRNAs targeting tomato ARF8A (AtU6 and AtSL7 promoters, structurally optimized gRNA scaffolds)DepositorInsert2 gRNAs targeting tomato ARF8A
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEE491
Plasmid#149292PurposeT-DNA encoding TRV2 with tRNA multiplexed truncated FT augmented gRNAs targeting NbAGsgRNA1, NbPDS3, NbAGsgRNA2DepositorInsertp35S:TRV2_tRNA_NbAGsgRNA1_NbPDS3sgRNA_NbAGsgRNA2_TrunFT:tNos
ExpressionPlantPromoter35SAvailable SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEE531
Plasmid#149290PurposeT-DNA encoding TRV2 with spacer multiplexed truncated FT augmented gRNAs targeting NbAGsgRNA1, NbPDS3, NbAGsgRNA2DepositorInsertp35S:TRV2_Spacer_NbAGsgRNA1_NbPDS3sgRNA_NbAGsgRNA2_TrunFT:tNos
ExpressionPlantPromoter35SAvailable SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEE495
Plasmid#149291PurposeT-DNA encoding TRV2 with direct repeat multiplexed truncated FT augmented gRNAs targeting NbAGsgRNA1, NbPDS3, NbAGsgRNA2DepositorInsertp35S:TRV2_Direct_NbAGsgRNA1_NbPDS3sgRNA_NbAGsgRNA2_TrunFT:tNos
ExpressionPlantPromoter35SAvailable SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTR(EF)-tRNA(Q)
Plasmid#170517PurposePCR template vector for amplifying gRNAcore(EF)-tRNA(Q) fragment; used together with pAC-U63-tgRNA-nlsBFP or pAC-U63-tgRNA-Gal80DepositorInsertgRNAcore(EF)-tRNA(Q)
UsePcr template vector for amplifying grnacore(ef)-t…Available SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCJ1023
Plasmid#228763PurposePlasmid expressing Cas9 and gRNAs for mouse Ift88 and Pkd2. Use for disruption of mouse Ift88 and Pkd2 in cultured cells.DepositorUseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterhuman U6Available SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDG459
Plasmid#100901PurposeSpCas9 with 2A-Puro and a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of double knock-outs and large deletions in a single plasmid system.DepositorInsertshumanized CRISPR associated protein 9
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTags3xFLAG and T2A-PuroRExpressionMammalianPromoterCBh and U6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pALuWBB
Plasmid#183202PurposedsRed marked transgene for Crispr co-conversion with w+ gRNA and drop in cloning sites for 2 more gRNADepositorInsertw+ gRNA and scaffold followed by 2 gRNA with BbsI and BsaI cloning sites
UseCRISPR; Recombines at attp landing site in fly ge…ExpressionInsectPromoterU6-3Available SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWT050d
Plasmid#107901PurposeW2.5-2 plasmid. Contains PLacO-sgRNA1, PRha-sgRNA6-(sgRNA4-C16T-C18T) and is part of CAMERA 2.5DepositorInsertPLacO-sgRNA1, PRha-sgRNA6-(sgRNA4-C16T-C18T)
ExpressionBacterialAvailable SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pWT019b
Plasmid#107894PurposeW1.2 plasmid. Contains PTetO-sd2U-Cas9, PLacO-sgRNA1, PRha-sgRNA2 (sgRNA1-G19T-G20C) and is part of CAMERA 1.2DepositorInsertPTetO-sd2U-Cas9, PLacO-sgRNA1, PRha-sgRNA2 (sgRNA1-G19T-G20C)
ExpressionBacterialAvailable SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
STAGR_SAMScaffold_hU6
Plasmid#102843PurposeCan be used as PCR template for a STAgR reactionDepositorInsertgRNAScaffold_hU6promoter
UseAs pcr templateAvailable SinceJan. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTC364
Plasmid#91213Purposeprotoplast vector expressing 2 gRNAs targeting tomato ARF8A (CmYLCV promoter, Csy4 processing)DepositorInsert2 gRNAs targeting tomato ARF8A
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTX209
Plasmid#89269PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsPDS gene, OsPDS-gRNA01 and OsPDS-gRNA02DepositorInsertOsPDS-gRNA01 and OsPDS-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC365
Plasmid#91214Purposeprotoplast vector expressing 2 gRNAs targeting tomato ARF8A (CmYLCV promoter, tRNA processing)DepositorInsert2 gRNAs targeting tomato ARF8A
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTX208
Plasmid#89268PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsYSA gene, OsYSA-gRNA01 and OsYSA-gRNA02DepositorInsertOsYSA-gRNA01 and OsYSA-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC363
Plasmid#91211Purposeprotoplast vector expressing 2 gRNAs targeting tomato ARF8A (AtU6 and AtU6 promoters)DepositorInsert2 gRNAs targeting tomato ARF8A
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only