We narrowed to 6,235 results for: cas9 expression plasmid
-
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS415-Cas9-VPR
Plasmid#163971PurposeTrifunctional Cas9-VPR fusion protein plasmid for simultaneous transcriptional activation, transcriptional repression, and genome editing in yeastDepositorInsertCas9-VPR
UseSynthetic BiologyExpressionYeastAvailable SinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-H2BC11_sgRNA
Plasmid#183883PurposepX459V2.0-HypaCas9 plasmid with H2BC11 sgRNA for C-terminal tagging of H2B histones in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-MYH10_sgRNA
Plasmid#183887PurposepX459V2.0-HypaCas9 plasmid with MYH10 sgRNA for N-terminal tagging of myosin heavy chain 10 in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEvolvR-enCas9-PolI3M-TBD
Plasmid#113077PurposeExpresses enCas9 fused to PolI3M-TBD in E. coli. contains a BsmbI-flanked GFP cassette for sgRNA cloning.DepositorInsertenCas9-PolI3M-TBD
ExpressionBacterialAvailable SinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Cas9C-VPR
Plasmid#80933PurposeExpresses Cas9C-VPR in mammalian cells.DepositorInsertCas9C-VPR
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SMVP-Cas9N-U6-gRNA M3
Plasmid#80936PurposeExpresses Cas9N in mammalian cells; expresses gRNA M3 for Mstn cleavage.DepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SMVP-Cas9N-U6-gRNA M4
Plasmid#80937PurposeExpresses Cas9N in mammalian cells; expresses gRNA M4 for Mstn cleavage.DepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
N-Terminal Split Cas9 D10A Nickase with GyrA intein
Plasmid#58695PurposeExpresses N-terminus of D10A SpCas9 nickase domain fused to a GyrA intein, flanked by ITRs for AAV packaging. Combine with C-Terminal Split Cas9 Gyra Intein for full length SpCas9 nickase productionDepositorInsertD10A Nickase humanized S. pyogenes Cas9 with Gyra Nsplit Intein
UseAAV and CRISPRTagsGyrA Nsplit Intein, HA Tag, and NLSExpressionMammalianMutationD10A nickase converting mutation to SpCas9PromoterCBhAvailable SinceSept. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHRdSV40-dCas9-10xGCN4_v4-P2A-BFP
Plasmid#60903PurposeExpressed a nuclease dead Cas9 tagged with 10 copies of the GCN4 peptide v4 and BFP. This plasmid is part of the SunTag system for gene activationDepositorInsertCas9 dead
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pX459_V2.0_pSpCas9(BB)-2A-Puro_T-REX17_Ex1_KI
Plasmid#195504PurposeCas9-2A-Puro expression vector bearing a sgRNA targeting Exon 1 of human lncRNA T-REX17DepositorInsertsgRNA
UseCRISPRTags3XFLAG, Puro, and T2AExpressionMammalianPromoterU6Available SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
2333_Cas9-CtIP-dnRNF168
Plasmid#200254PurposeThis plasmid expresses the Cas9-CtIP-dnRNF168 in mammalian cellsDepositorInsertCas9-CtIP-dnRNF168
ExpressionMammalianPromoterCMVAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-HF1-plus
Plasmid#126768PurposeExpression plasmid for human codon-opt. increased fidelity SpCas9-HF1-plus (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with close to the same fidelity as SpCas9-HF1DepositorInsertSpCas9-HF1-plus
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A; Q695A; Q926A; amino acids 1005-1013 replac…PromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6-CjCas9-MS2gRNA-Backbone
Plasmid#210711PurposeThis plasmid express MS2 loop containing Cj Cas9 gRNADepositorInsertMS2 loop containing Cj Cas9 gRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330-NL-DHFR-SpCas9
Plasmid#124522PurposeExpresses SpCas9 fused to DHFR domains on both the N-terminus and an internal loop in mammalian cellsDepositorInsertNL-DHFR-SpCas9
UseAAVTagsDestabilized domain of E.coli dihydrofolate reduc…ExpressionMammalianPromoterCbhAvailable SinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G3
Plasmid#86611PurposeExpresses the ATP1A1 G3 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 intron 4. Px330-like plasmidDepositorInsertATP1A1 G3 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via hdr using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G2
Plasmid#86610PurposeExpresses the ATP1A1 G2 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 exon 4. Px330-like plasmidDepositorInsertATP1A1 G2 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via nhej using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable SinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV_Cas9–superNLS
Plasmid#232430PurposeExpression plasmid for the SpCas9 nuclease with superNLSDepositorInsertCas9–superNLS
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_APOBEC-1_hSt1Cas9_LMD9_2xUGI_3xHA
Plasmid#136652PurposeExpresses St1BE4max-LMD9 in mammalian cells along with its U6-driven sgRNADepositorInsertsUseCRISPR and Synthetic BiologyTags2xUGI, APOBEC-1, SV40 NLS, UGI, and hSt1Cas9ExpressionMammalianPromoterCAG and U6Available SinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only