We narrowed to 17,856 results for: por
-
Plasmid#132524PurposeFull length human dynein 2 heavy chain DYNC2H1, Sf9 codon optimised. With 8xHis-ZZ tag, TEV cleavage site, SNAPf tag, precission cleavage site at N-terminus. Assembled from synthesised fragmentsDepositorInsertDYNC2H1 (DYNC2H1 Human)
Tags8x His, Linker-TEV-linker-TEV, Precission cleavag…ExpressionInsectMutationCodon optimised for Sf9 expressionAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
RKS-Fzd7/8 subtype NGS Wnt
Plasmid#159628PurposeExpress Fzd7/8 subtype NGS Wnt in mammalian cellsDepositorInsertFzd7/8 subtype NGS Wnt
UseLentiviralTagsHis tagExpressionMammalianAvailable SinceSept. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-EGFP-PARP1
Plasmid#176146PurposeEGFP fused to the N-terminus of PARP1 & a hygromycin resistance cassetteDepositorInsertPoly(ADP-Ribose) Polymerase 1 (PARP1 Human)
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1AAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC45A1
Plasmid#132289PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC45A1 (SLC45A1 Human)
ExpressionMammalianAvailable SinceNov. 12, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.1-ERBB2-V5/HIS
Plasmid#201103Purposeexpression of human ERBB2 receptor tyrosine kinase in mammalian cellsDepositorInserthuman ERBB2 receptor tyrosine kinase, full length, wildtype (ERBB2 Human)
TagsV5/HisExpressionMammalianPromoterCMVAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
ptdTHC
Plasmid#112617Purposepromoterless expression plasmid driving multicistronic cassette H2BtdTomato_p2A_HygroR_p2A_CreERt2DepositorInsertsUsePromoterless vector, ready for promoter for mamma…TagstdTomatoExpressionMammalianPromoterNo PromoterAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC4A2_STOP
Plasmid#161442PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC4A2 (SLC4A2 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMIH-TOMM20-Halo
Plasmid#111626PurposeFusion protein used to visualise mitochondria upon the addition of Halo specific dye, has hygromycin selectionDepositorAvailable SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPD292 PPH/HBB_IVS2/-T2A-dCas9-NFZ-P2A-BFP
Plasmid#249156PurposeOverexpression of PPH-T2A-dCas9-NFZ-P2A-BFP with HBB IVS2 intron in PPH coding sequence and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertPPH/HBB_IVS2/-T2A-dCas9-NFZ-P2A-mTagBFP2 (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC4A1_STOP
Plasmid#161346PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC4A1 (SLC4A1 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCMVtrunc msfGFPΔC9-LifeactΔN2
Plasmid#231556PurposeMammalian expression of N-terminally truncated Lifeact fused to C-terminally truncated monomeric superfolder GFP for actin filament organization measurements using fluorescence polarization microscopyDepositorAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_MFSD10
Plasmid#131890PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertMFSD10 (MFSD10 Human)
ExpressionMammalianAvailable SinceOct. 9, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC44A1_STOP
Plasmid#161079PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC44A1 (SLC44A1 Human)
ExpressionMammalianAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC25A16_STOP
Plasmid#161145PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC25A16 (SLC25A16 Human)
ExpressionMammalianAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221_FLVCR1
Plasmid#131892PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertFLVCR1 (FLVCR1 Human)
ExpressionMammalianAvailable SinceOct. 9, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLL3.7-EF-EYFP-YAP1_5SA-PolyA
Plasmid#112285PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) 5SA active mutant - serines 61, 109, 127, 164 and 397 (also known as 381 in other isoforms)DepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationHuman YAP1-2gamma with 5 Serines (61, 109, 127, 1…PromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBI121::chitEclipGFP:LAAQ
Plasmid#240452PurposeExpression of indicator protein fusion (modified ecliptic pHluorin & low affinity Aequorin) for monitoring calcium concentrations and pH in cell walls of higher plants. See Resource Information.DepositorInsertFusion of Chitinase signal, soluble modified ecliptic pHluorin and low affinity Aequorin (D119A)
ExpressionBacterial and PlantMutationEcliptic GFP (ecliptic pHluorin) (PMID 9671304); …PromoterCauliflower mosaic virus 35S promoter (GenBank AJ…Available SinceSept. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
CL20_MSCV-ires-GFP
Plasmid#237496PurposeRetroviral empty vectorDepositorTypeEmpty backboneUseRetroviralExpressionMammalianAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-MFSD1_STOP
Plasmid#161082PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertMFSD1 (MFSD1 Human)
ExpressionMammalianAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
CMV-LAMP1-HaloTag
Plasmid#164209PurposeExpresses HaloTag tagged LAMP1 under CMV promoterDepositorAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDEST-mCherry-ARHGEF2
Plasmid#207959PurposeExpression vector for ARHGEF2 (GEF-H1) with an N-terminal mCherry tagDepositorAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX335 HTT sgRNA-a
Plasmid#87201PurposepX335 vector encoding SpCas9n and a chimeric guide RNA targeting exon 1 of HTTDepositorAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX335 HTT sgRNA-b
Plasmid#87200PurposepX335 vector encoding SpCas9n and a chimeric guide RNA targeting 5' UTR of HTTDepositorAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti_SIV-(SalI)-syn-IRES-mEmerald-CaV2.1 WPRE
Plasmid#236239PurposeLentiviral expression of voltage-gated calcium channel, CaV2.1, N-terminally tagged with mEmeraldDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC18B1_STOP
Plasmid#161187PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC18B1 (C6orf192 Human)
ExpressionMammalianAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pME-Actin-Vhh-sfGFP-P2A-1xHA-tdiRFP-caax (JDW 1311)
Plasmid#224497PurposeGateway compatible middle entry clone containing an Actin nanobody fused to sfGFP followed by P2A and tdiRFP-caax tag (GFP actin reporter and cell membrane iRFP reporter)DepositorInsertActin-Vhh-sfGFP-P2A-HA-tdiRFP-caax
UseGateway cloningAvailable SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGBacmam-NGS Wnt-Fc
Plasmid#159629PurposeExpress Fc-tagged Fzd7/8 subtype NGS Wnt in mammalian cells for organoid researchDepositorInsertFzd7/8 subtype NGS Wnt Fc
TagsFc tag and His tagExpressionMammalianPromoterCMVAvailable SinceSept. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCag FlpO-2A-Cre EV
Plasmid#129419Purposeepisomal expression of FlpO and Cre recombinasesDepositorInsertFlpO-2A-Cre
UseCre/Lox and Unspecified; Episomal expression vect…ExpressionMammalianPromoterCMV/Chick β-actin (CAG)Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC7A5_STOP
Plasmid#161363PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC7A5 (SLC7A5 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits