We narrowed to 32,144 results for: LIS;
-
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pC129: pAAV.CMV-CasRx mCh
Plasmid#203442PurposePlasmid expressing active RfxCas13d with mCherry reporter for investigating CasRx activityDepositorInsertRfxCas13d-T2A-mCherry
UseAAV and CRISPRExpressionMammalianPromoterCMVAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Tag2B-E2F3
Plasmid#202522PurposeExpressing human E2F3 protein with FLAG-tagDepositorAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-mA3-BE3
Plasmid#113419PurposeExpresses mA3-BE3 in mammalian cellsDepositorInsertmA3-BE3 (Apobec3 Mouse, S. pyogenes and Bacteriophage PBS2)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCD5-H5_Vietnam_1203/04_sfGFP_ST
Plasmid#182546PurposeExpresses a sfGFP fused H5 protein of the prototype A/Vietnam/1203/04 virusDepositorInsertH5_Vietnam_1203_04
TagsGCN4-TEV-sfGFP-TwinStrepExpressionMammalianPromoterCMVAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-HaloEKAR2.2-T2A-EGFP
Plasmid#216495PurposeExpression of chemigenetic ERK biosensor (low basal brightness, extremly high dynamic range) and EGFP transfection marker in mammalian cellsDepositorInsertHaloEKAR2.2
TagsT2A-EGFPExpressionMammalianPromoterCMVAvailable SinceJune 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 6B CARD8 UPA-CARD-mCherry R464E
Plasmid#164013PurposeMammalian expression vector encoding CARD8 UPA-CARD (filament-deficient mutation) with a C-terminal mCherry tag for imagingDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-FLAG-MYO1D
Plasmid#125125PurposeExpresses human FLAG-MYO1DDepositorAvailable SinceMay 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-eGFP-SV40p-BlasR
Plasmid#228271PurposepLenti-CMV-eGFP-SV40p-BlasR plasmid for ectopic expression of GFPDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-LivePARBackbone
Plasmid#176526PurposeExpression vector with a BamHI site in-frame with a Gly-Ser linker fused to EGFP; serves as the backbone for PAR binding domain incorporation for LivePARDepositorTypeEmpty backboneUseLentiviralTagsEGFPExpressionMammalianPromoterEF1AAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
HMGN1_pLENTI-CAG-IRES-GFP
Plasmid#176995PurposeMammalian lentiviral expression vector encoding HMGN1DepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-GST-4
Plasmid#228986PurposeFor bacterial expression of anti-GST nanobody GST-4, with pelB leader for periplasmic secretion, and C-term 6xHIS tag.DepositorInsertGST-4
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaRIgG-2
Plasmid#228996PurposeFor bacterial expression of anti-rabbit IgG nanobody LaRIgG-2, with pelB leader for periplasmic secretion, and C-term free cysteine and C-term 6xHIS tag.DepositorInsertLaRIgG-2
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaGIgG-12
Plasmid#228999PurposeFor bacterial expression of anti-mouse IgG nanobody LaMIgG-12, with pelB leader for periplasmic secretion, and C-term free cysteine and C-term 6xHIS tag.DepositorInsertLaGIgG-12
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-GST-3
Plasmid#228985PurposeFor bacterial expression of anti-GST nanobody GST-3, with pelB leader for periplasmic secretion, and C-term 6xHIS tag.DepositorInsertGST-3
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDB.His.MBP.3C CARD8 CARD WT
Plasmid#164022PurposeBacterial expression vector encoding a HRV 3C-cleavable His-MBP-tagged CARD8 UPA-CARDDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLex 983-Micu2
Plasmid#50372PurposeExpression in mammalian cellsDepositorAvailable SinceJan. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Tag4/hL3MBTL1
Plasmid#28231DepositorInsertl(3)mbt-like 1 (Drosophila) (L3MBTL1 Human)
TagsFLAGExpressionMammalianMutationIrrelevant S49T mutationAvailable SinceFeb. 28, 2011AvailabilityAcademic Institutions and Nonprofits only -
pSpCAS9 wt (BB)-2A-GFP targeting human TRIM21
Plasmid#138295PurposegRNA for CRISPR/Cas9 knockout of human TRIM21DepositorAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
MiniCoopR mitfa:NRAS
Plasmid#118847PurposeExpresses human NRAS Q61R mutant and zebrafish mitfa specifically in zebrafish melanocytesDepositorAvailable SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only