We narrowed to 2,654 results for: cag promoter
-
Plasmid#68830PurposeExpresses c-myc-tagged human RAD18 deleting SAP domainDepositorInsertc-myc tagged human RAD18 deleting SAP domain (RAD18 Human)
Tagsc-mycExpressionMammalianPromoterCAGAvailable SinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18 dC2
Plasmid#68831PurposeExpresses c-myc-tagged human RAD18 deleting Polymerase eta binding domainDepositorInsertc-myc tagged human RAD18 deleting Polymerase eta binding domain (RAD18 Human)
Tagsc-mycExpressionMammalianPromoterCAGAvailable SinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18 d6BD
Plasmid#68832PurposeExpresses c-myc-tagged human RAD18 deleting hRAD6 binding domainDepositorInsertc-myc tagged human RAD18 deleting hRAD6 binding domain (RAD18 Human)
Tagsc-mycExpressionMammalianPromoterCAGAvailable SinceOct. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18 C207F
Plasmid#68829PurposeExpresses c-myc-tagged human RAD18 with C207F mutationDepositorInsertc-myc tagged human RAD18 with C207F mutation (RAD18 Human)
Tagsc-mycExpressionMammalianPromoterCAGAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
PB-GFP-Gal8
Plasmid#127191PurposePiggybac transposon plasmid with CAG promoter GFP-Galectin 8 (GFP-Gal8) fusion protein. Useful as genetically encoded endosomal escape sensor.DepositorInsertGFP-Gal8 (LGALS8 Human)
TagsGal8 is fused to the c-terminus of GFPExpressionMammalianPromoterCMVAvailable SinceDec. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-SpCas9D10A nickase
Plasmid#216737PurposeExpresses SpCas9-D10A nickase from a CMVd1 promoter. For AAV packaging. Derived from pAAV-CMV-SpCas9 (Addgene #113034)DepositorArticleInsertCas9-D10A nickase
UseAAV and CRISPRExpressionMammalianMutationD10APromoterCMVd1Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-SpCas9D10A nickase
Plasmid#216736PurposeExpresses SpCas9-D10A nickase from a nEF promoter. For AAV packaging. Derived from pAAV-nEF-SpCas9 (Addgene #87115)DepositorArticleInsertCas9-D10A nickase
UseAAV and CRISPRExpressionMammalianMutationD10APromoterEF-1-alpha coreAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV(gRNA)-CMV-eGFP-U6(sgCTG)
Plasmid#216732PurposeContains a eGFP gene along with a U6 promoter driving the sgCTG (target sequence: (CUG)6). Used with the HD iPSC-derived astrocytesDepositorArticleInsertsgCTG lentiviral guide RNA with eGFP tag
UseCRISPR and LentiviralExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTalpha1-Dre
Plasmid#133925PurposeNeuron-specific expression of DreDepositorInsertHA-Dre
TagsHAExpressionMammalianPromoterCAG promoterAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBT224_(pCA-tTA2)
Plasmid#36430DepositorInserttetracycline transactivator
ExpressionMammalianPromoterCAG (chicken beta actin promoter and CMV enhancer)Available SinceJune 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
pHIE043 ZF43x1 mKate2 (TUPV1)
Plasmid#138723PurposemMoClo TUPV, with ZF43x1 promoter and mKate2 in the MCSDepositorInsertZF43x1
UseSynthetic BiologyExpressionMammalianPromoterZF43x1Available SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHIE042 ZF43x0 mKate2 (TUPV1)
Plasmid#138722PurposemMoClo TUPV, with ZF43x0 promoter and mKate2 in the MCSDepositorInsertZF43x0
UseSynthetic BiologyExpressionMammalianPromoterZF43x0Available SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLSU1/MtHp:nnLuz-I{PIV-216}:NosT
Plasmid#212192PurposeThis binary vector expresses mushroom luciferase (nnLuz) containing the PIV intron (216 bp into the gene) with the strong Medicago trunculata MtHP promoter and UTRDepositorInsertnnLuz-I{PIV-216}
ExpressionPlantMutationPIV intron added at bp 216, eliminates expression…PromoterMedicago trunculata MtHP promoterAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOPTXcGMPRELUC
Plasmid#68503Purposecyclic nucleotide reporter for bacteria or plant cellsDepositorInsertOPTX promoter with cGMPRE (AT1G33440 Mustard Weed)
TagsluciferaseExpressionBacterial and PlantMutation3x cGMPRE inserted 190bp 5' of ATG (cGMPRE =…PromoterOPTX promoter with cGMPREAvailable SinceSept. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_MTOR_Nick_Intron-45_Dual_sgRNA
Plasmid#178106PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G8 and MTOR Nick intron-45 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G8 + MTOR nick intron-45 sgRNAs
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2 probasin_mTQ2_FlpO
Plasmid#68405PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex8 and SMAD4 ex2. are expressed by the U6 promoterDepositorInserts3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2
FlpO
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianPromoterSynthetic Probasin ARRx2 and U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSP571
Plasmid#139498PurposeCRISPR-Cas9 plasmid to generate double strand break in STL1 locus in S. cerevisiae. Expresses both Cas9 and STL1 sgRNADepositorInsertpGPD Cas9 / sgRNA (STL162)
ExpressionYeastMutationWTPromoterpGPDAvailable SinceJune 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-SpCas9-miniU6-sgRNAShank3
Plasmid#213973PurposeAAV vector to express SpCas9 driven by pCALM1 promoter for targeting Shank3 locusDepositorInsertShank3 sgRNA
UseAAV and CRISPRAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_RRT8
Plasmid#166080PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of RRT8 for double stranded break formation in yeast.DepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
scAAV-hIBA1a-GFP
Plasmid#214146PurposeSelf-complementary AAV vector packaging GFP under the human Iba1 promoterDepositorInsertGFP
UseAAVAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-tTA
Plasmid#149363PurposeAAV-mediated and Cre-dependent expression of tTA under the CAG promoter.DepositorInserttTA2
UseAAV and Cre/LoxExpressionMammalianAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18
Plasmid#68827PurposeExpresses c-myc-tagged human RAD18DepositorAvailable SinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBT259_(pRosa26-G-tTA2)
Plasmid#36878DepositorInsertsGFP
tTA2
beta-globin intron
Neo
diphteria toxin A
ExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_version2_U6_AtPDS3_gRNA10
Plasmid#197952PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter, with SV40 NLS at the C-terminal , and the AtPDS3 guide RNA 10 driven by U6 promoter.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterAtU6-26 and pUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_V2_2x35Sp_HSP18t_ribozyme_AtPDS3_gRNA10
Plasmid#197959PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter and a single AtPDS3 gRNA driven by 2x35Sp and flanked by ribozymes.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoter2x35S promoter and pUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_V2_pUB10_E9t_ribozyme_AtPDS3_gRNA10
Plasmid#197960PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter and a single AtPDS3 gRNA driven by UBQ10 gene promoter and flanked by ribozymes.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterpUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-sFLEx-HA-SpCas9-miniU6-sgRNAShank3
Plasmid#213969PurposeAAV vector for encoding SpCas9 driven by pCALM1 promoter targeting Shank3 locus in the presence of Cre recombinaseDepositorInsertShank3 sgRNA
UseAAV and CRISPRAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_RPL39
Plasmid#166078PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of RPL39 for double stranded break formation in yeast.DepositorInsertPromoter of RPL39 (Overlaps with 5'UTR and first base of gene) (RPL39 Budding Yeast)
UseCRISPRExpressionYeastPromoterTet-inducibleAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
Banshee-ShCit-A
Plasmid#85216PurposeShort hairpin RNAs were designed to target murine Cit (encoding Citron Rho-interacting kinase) and were subcloned into the Banshee-GFP vector for expression under control of the H1 promoter.DepositorInsertshCit-A
UseRetroviralExpressionMammalianPromoterH1Available SinceFeb. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
Banshee-ShCit-B
Plasmid#85217PurposeShort hairpin RNAs were designed to target murine Cit (encoding Citron Rho-interacting kinase) and were subcloned into the Banshee-GFP vector for expression under control of the H1 promoter.DepositorInsertshCit-B
UseRetroviralExpressionMammalianPromoterH1Available SinceFeb. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
MtPT4-p3
Plasmid#160003PurposeMultigene construct containing the betalain pigment biosynthetic genes under the control of the MtPT4 promoter for visualisation of arbuscular mycorrhizal colonisation in Medicago truncatula roots.DepositorInsertsDsRed (reverse orientation)
DODAα1
CYP76AD1
cDOPA5GT
ExpressionPlantPromoterArabidopsis thaliana Ubiquitin 10 Promoter (AtUb1…Available SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7 probasin_mTQ2_FlpO
Plasmid#68356Purpose-The prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and SMAD4 ex2. are expressed by the U6 promoterDepositorInserts4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7
FlpO recombinase
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianPromoterSynthetic Probasin ARRx2 and U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG
Plasmid#70183PurposeInducible expression of guide RNA with fluorescent GFP reporterDepositorInsertH1-Tet-sgrna cassette
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBigTB-ERT2CreERT2
Plasmid#149433Purposetamoxifen-inducible Cre recombinaseDepositorInsertERT2-Cre-ERT2 fusion protein
UseCre/Lox and Mouse TargetingTagsERT2ExpressionMammalianPromoterCAG promoterAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBigTB-CreERT2
Plasmid#149434Purposetamoxifen-inducible Cre recombinaseDepositorInsertCre-ERT2 fusion protein
UseCre/Lox and Mouse TargetingTagsERT2ExpressionMammalianPromoterCAG promoterAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBigTB-FlpERT2
Plasmid#149435Purposetamoxifen-inducible Flp recombinaseDepositorInsertFlp-ERT2 fusion protein
UseCre/Lox and Mouse TargetingTagsERT2ExpressionMammalianPromoterCAG promoterAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pART (pT-2)
Plasmid#62708PurposeMammalian expression of tdTomato from the broadly active CAG promoter/enhancerDepositorInserttdTomato
ExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only