We narrowed to 8,906 results for: sgrna
-
Plasmid#79006PurposeExpresses WT Cas9 and GFP, along with a sgRNA to mouse Tfeb.DepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only
-
epi-ABEmax-NG
Plasmid#135976PurposeExpresses ABEmax(with SpCas9-NG), EBNA1 and blasticidin resistence gene; cloning backbone for sgRNA; Contains Epstein-Barr virus oriP replication originDepositorTypeEmpty backboneExpressionMammalianAvailable SinceMay 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
BB3cH_pGAP_23*_pPFK300_Cas9
Plasmid#104912PurposehCas9 under control of pPFK300 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on HygDepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRExpressionYeastAvailable SinceJan. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
LCV2 control
Plasmid#217443PurposeLentiviral vector expressing Cas9 without a targeting sgRNADepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
FUGW U6 gL1HSg2dCas9-KRAB-T2a-GFP
Plasmid#234881PurposeL1HS-silencing plasmid (CRISPRi gRNA2)DepositorInsertLacZ gRNA
UseCRISPR and LentiviralTagsGFPExpressionMammalianAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Sa-SauriCas9
Plasmid#135967PurposeExpresses Sa-SauriCas9, and cloning backbone for sgRNADepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
BB3cK_pGAP_23*_pLAT1_Cas9
Plasmid#104908PurposehCas9 under control of LAT1 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on G418DepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRExpressionYeastAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-TJP1
Plasmid#227300PurposeDonor template for mStayGold insertion into the N-terminus of the TJP1 locus. For tight junction visualization. To be co-transfected with sgRNA plasmid px330-TJP1 (Addgene #227299)DepositorInsertTJP1 Homology Arms flanking a mStayGold Tag (TJP1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT42
Plasmid#223414PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for monocot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpRY-D10A-ZmUbi-gRNA scaffold-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT38
Plasmid#223410PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for dicot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by ZmUbi1 and the sgRNA was driven by AtU3 promoter; BASTA for plants select.DepositorInsertZmUbi-ecTadA8e-SpRY-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT27
Plasmid#223399PurposeT-DNA vector for PmCDA1-CBE_V04 based C-to-T base editing for dicot plants; NGG PAM; 5' editing window; PmCDA1-CBE_V04 was driven by 2x35s and the sgRNA was driven by AtU3; Kanamycin for plant select.DepositorInsert2x35s-SpCas9D10A-PmCDA-UGI-T2A-MS2-UGI-AtU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT25
Plasmid#223397PurposeT-DNA vector for PmCDA1-CBE_V04 based C-to-T base editing for dicot plants; NGG PAM; 5' editing window; PmCDA1-CBE_V04 was driven by AtUBQ10 and sgRNA was driven by AtU3; Hygromycin for plants select.DepositorInsertAtUBQ10-SpCas9D10A-PmCDA-UGI-T2A-MS2-UGI-AtU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
HuEx-2xNLS-iGeoCas9(C1)-2xNLS_EGFP-g1
Plasmid#222993PurposeMammalian expression of iGeoCas9(C1) construct with EGFP-targeting sgRNADepositorInsertHuEx-2xNLS-iGeoCas9(C1)-2xNLS_EGFP-g1
UseCRISPRTagsPuroExpressionMammalianPromoterpCAGAvailable SinceJuly 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMCB619
Plasmid#171011PurposeCRISPR sgRNA vector (puro-BFP with BstXI/BlpI digest sites).DepositorInsertU6:sgRNA_Puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromotermU6Available SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
p2T-CAG-SpCas9-BlastR
Plasmid#107190PurposeConfers constitutive expression of SpCas9DepositorInsertSpCas9 (NEWENTRY )
UseCRISPRTags3xFLAGExpressionBacterial and MammalianPromoterChicken ß-actinAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAC2-dual-dCas9VP48-sgExpression
Plasmid#48236PurposeDual expression construct expressing both dCas9VP48 and sgRNA from separate promotersDepositorInsertdCas9VP48
UseCRISPRTagsHA-tag and VP48ExpressionMammalianMutationD10A H840A (catalytically inactive)Available SinceSept. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
dCas9-NS3-NLS/VPR
Plasmid#112244PurposeEncodes the drug-preservable Cas9-NS3-NLS/VPR, which can be used to activate gene expression when combined with an NS3 inhibitor and appropriately designed sgRNA.DepositorInsertdCas9-NS3-NLS/VPR
TagsAU1 (N term on NS3) and HA (C term on NS3)ExpressionMammalianMutationNS3 mutant T54APromoterCMVAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
HuEx-1xNLS-iNme2Cas9-npNLS_EGFP-T1
Plasmid#222992PurposeMammalian expression of iNme2Cas9 construct with EGFP-targeting sgRNADepositorInsertHuEx-1xNLS-iNme2Cas9-npNLS_EGFP-T1
UseCRISPRTagsPuroExpressionMammalianPromoterpCAGAvailable SinceJuly 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTPH413
Plasmid#185728PurposeBacterial PAM profiling of adenine base editor variantsDepositorInsertsecTadA(8e)-neNme2-C
Nme2Cas9 sgRNA
UseCRISPRExpressionBacterialMutationNme2Cas9 P6S/D16A/E33G/K104T/D152A/F260L/A263T/A3…Available SinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only