We narrowed to 24,081 results for: CRISPR
-
Plasmid#86555PurposeSubcloning of any sgRNA via BbsI sites. Note that there is an improved version of this plasmid (Addgene 105866) that results in up to 10x greater efficiencyDepositorInsertU6-26p::sgRNA scaffold
UseCRISPR; SubcloningPromoterArabidopsis U6-26 promoterAvailable SinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCJH002_10xHis-MBP-TEVcs-Cas12c(4)_Amp
Plasmid#183069PurposeBacterial protein expression plasmid of wild-type Cas12c_4. This is a R965H version of the Cas12c in Harrington et al., 2020.DepositorInsertCas12c_4
UseCRISPRTagsHis10 and MBPExpressionBacterialMutationWild-typeAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYZ145
Plasmid#98405PurposeDonor DNA plasmid to introduce leu1 deletion in S. pombe. Linearization with Not1 digestion.DepositorInsertsUseCRISPR and Synthetic BiologyAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC6
Plasmid#104780PurposepSC218UG-At Ubiquitin10:Gateway expression cassette binary vectorDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceJan. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYZ149
Plasmid#98407PurposeDonor DNA plasmid to introduce his3 deletion in S. pombe. Linearization with Not1 digestion.DepositorInsertsUseCRISPR and Synthetic BiologyAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAWp30
Plasmid#73857PurposepFUGW-EFSp-Cas9-P2A-ZeoDepositorInsertEFSp-Cas9-P2A-Zeo
UseLentiviralAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hMYOD1 gRNA_1-MS2-Puro
Plasmid#192673PurposeLentiviral expression of sgRNA targeting hMYOD1 promoter to activate human MYOD1 transcriptionDepositorInsertHuman MYOD1 activating gRNA #1 (MYOD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-crScaffold_SV40-BFP
Plasmid#224860PurposecrRNA scaffold for RfxCas13d expressed from hU6 promoter and reporter BFP protein expressed from SV40 promoterDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionMammalianPromoterhU6Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgSlc17a8
Plasmid#124861PurposeMutagenesis of Slc17a8DepositorInsertSlc17a8 (Slc17a8 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pShoHELIX-sgRNA_entry (BO3)
Plasmid#181784PurposeExpresses ShoHELIX containing a nicking I-AniI fusion to ShoTnsB. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertnAniI-ShoTnsB, ShoTnsC, ShoTniQ, ShoCas12k
ExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT005
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVCERC-5 Pvan-dcas9 (Sth3)
Plasmid#133319Purposeexpresses dcas9 from Streptococcus thermophilus #3; induced with vanillate; for homologous recombination at the vanillate locus in Caulobacter crescentus; tetracycline resistanceDepositorInsertdcas9 (Streptococcus thermophilus #3)
UseUnspecifiedPromotervanillateAvailable SinceJan. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUb dRxCas13d + RxCas13d guide RNA
Plasmid#176304PurposeExpresses catalytic dead RxCas13d and its associated guide RNA in Drosophila cellsDepositorInsertRxCas13d
TagsHA tagExpressionInsectMutationR239A, H244A, R858A, H863APromoterUbi-p63eAvailable SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141D-gRNA2.1
Plasmid#167161PurposeExpress single gRNA with gRNA2.1 scaffold (with four MS2 binding sites) under OsU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterOsU3Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
CMV-AsCas12f-v4.1
Plasmid#204636PurposeExpression of AsCas12f v4.1 in mammalian cellsDepositorInsertAsCas12f-v4.1
TagsNLSExpressionMammalianMutationD169K, N199K, N328G, D364RPromoterCMVAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU1/Sm/3' Box_(GLuc)_TOP1
Plasmid#68437PurposeTransient expression of the "TOP1" construct, targeting the GLuc reporter, in mammalian cells. U1Pro/SmBox/3' Box expression backbone.DepositorInsertTOP1 construct
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U1Available SinceSept. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYPQ262m3
Plasmid#149556PurposeGateway entry clone for CRISPR-iSpyMacCas9 ABE7.10 A-G base editing at NAAR PAMsDepositorInsertecTadAwt-ecTadAmut-ziSpyMacCas9(D10A)
UseCRISPRExpressionPlantMutationD10A, R221K, N394K, Protospacer interacting domai…Available SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-mGreenLantern/EGFP
Plasmid#179913PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting mGreenLantern and EGFP fluorescent proteins.DepositorInsertmGreenLantern/EGFP sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBS-KS-attB1-2-PT-SA-SD-2-2xTY1-V5
Plasmid#61257PurposeCRISPR-RMCE, second step attB plasmid, intron phase 2, exchange dsRed with 2xTY1 and V5 tags cassetteDepositorInsert2xTY1-V5
UseCRISPRTagsTY1 and V5Available SinceNov. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
CL7_2xNLS_iGeoCas9(G)_2xNLS_His
Plasmid#222989PurposeBacterial expression of iGeoCas9(G) constructDepositorInsertCL7_2xNLS_iGeoCas9(G)_2xNLS_His
UseCRISPRTagsCL7 and HisExpressionBacterialPromotertacAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only