We narrowed to 27,839 results for: CAT
-
Plasmid#85464PurposeNatural anion conducting Channelrhodopsin with cyan absorption. Closing kinetics 140ms. High conductivity. Codon optimized for mammalian expression (human/mouse)DepositorInsertSynthetic construct ACR1 gene
TagsmCherryExpressionMammalianPromoterCMV (+enhancer)Available SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSRalpha-MSV-mouse Cdk4wt-Tk-neo
Plasmid#115525PurposeMammalian expression constructDepositorInsertMouse Cdk4 (Cdk4 Mouse)
UseRetroviralAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1V5-His Snk/Plk2 T239A
Plasmid#22219DepositorInsertSnk/Plk2 (PLK2 Human)
ExpressionMammalianMutationsingle amino acid substitution mutant, threonine …Available SinceAug. 28, 2012AvailabilityAcademic Institutions and Nonprofits only -
mTFP1-Vinculin-23
Plasmid#55516PurposeLocalization: Focal Adhesions, Excitation: 462, Emission: 492DepositorAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
H1.224.M.luc
Plasmid#193705PurposeExpresses a truncated PolIII H1 promoter of 224 nucleotides (H1.224) with the TATA box mutatedDepositorInsertTruncated PolIII H1 promoter (H1.224) with the TATA box mutated
UseLuciferaseExpressionMammalianAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
H1.99.luc
Plasmid#193663PurposeExpresses a truncated Polymerase III H1 promoter of 99 nucleotides (H1-99)DepositorInsertTruncated Pol III H1 promoter (H1.99) + 41 nucleotides
UseLuciferaseExpressionMammalianAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUCHR-inmCherry
Plasmid#60239PurposeHIV-1 transfer vector that encodes mcherry reporter gene interrupted by intronDepositorInsertinmCherry
UseLentiviralAvailable SinceAug. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBB75-ncRNA
Plasmid#194087PurposeExpresses Ec86 ncRNA in Escherichia coliDepositorInsertEc86 ncRNA
PromoterT7Available SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUCHR-inGFPt
Plasmid#60237PurposeHIV-1 transfer vector that encodes gfp-turbo reporter gene interrupted by intronDepositorInsertinGFPt
UseLentiviralAvailable SinceAug. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCRU5-inmCherry
Plasmid#60238PurposeHTLV-1 based transfer vector encoding mcherry reporter gene interrupted by intronDepositorInsertinmCherry
UseRetroviralAvailable SinceAug. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1V5-His Snk/Plk2 T239D
Plasmid#22220DepositorInsertSnk/Plk2 (PLK2 Human)
ExpressionMammalianMutationsingle amino acid substitution mutant, threonine …Available SinceAug. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGS_N_3xFLAG
Plasmid#101654PurposeExpression of type I signal-peptide containing proteins with N-terminal 3xFLAG-tag in insect cellsDepositorInsertLRP6 Signal peptide, KpnI linker, 3xFLAG tag
Tags3xFLAG tagExpressionInsectAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
1099-N-cadherin-AAA-YFP
Plasmid#32237DepositorInsertN-cadherin (Cdh2 Mouse)
TagsEYFPExpressionMammalianMutationGlu–Glu–Asp (aa 780–782) ---> Ala–Ala–AlaPromoterCMVAvailable SinceOct. 26, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Tag/M1 S245X
Plasmid#92366Purposeexpression of M1 S245X spastin in mammalian cellsDepositorInsertspastin (SPAST Human)
ExpressionMammalianMutation1-194 bp of 5'UTR deleted, S245XPromoterCMVAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSilencer2.1-U6-3JB8F+12
Plasmid#190854PurposeFor mammalian expression of 3JB8F+12, a dual-specificity aptamer that binds OGT and β-catenin. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a folded linker.DepositorInsert3JB8F_T1+12bp (A Dual-Specificity aptamer targeting OGT and β-catenin)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
MS2-adRNA (5'UAG)
Plasmid#170126PurposeLentiviral vector carrying 2 copies of the MS2 adRNA targeting a UAG at the 5' end of the ADAR2 deaminase domain in plasmids #170124 and 170125DepositorInsertMS2-ADAR2(5'UAG)-MS2
UseLentiviralExpressionMammalianPromoterHuman U6 and mouse U6Available SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1V5-His Snk/Plk2 D223N
Plasmid#22218DepositorInsertSnk/Plk2 (PLK2 Human)
ExpressionMammalianMutationsingle amino acid substitution mutant, aspartic a…Available SinceAug. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN (K29,30A)-mVenus
Plasmid#168485PurposeMammalian expression of the K29,30A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus.DepositorInsertthe K29,30A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Tag/M87 S245X
Plasmid#92368Purposeexpression of M87 S245X spastin in mammalian cellsDepositorAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSilencer2.1-U6-NL8F100
Plasmid#190852PurposeFor mammalian expression of NL8F100, a dual-specificity aptamer that binds OGT and β-catenin. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a flexible linker.DepositorInsertNL8F100 (A Dual-Specificity aptamer targeting OGT and β-catenin)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTorPE-Y-GECO1
Plasmid#55765PurposeEncoded a yellow fluorescent calcium ion indicator with inverted fluorescence response for expression in bacterial cellsDepositorInsertY-GECO1.0
UseLab constructedTags6x His tagExpressionBacterialPromoterpBADAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1‐Afu‐rnhBΔPIP
Plasmid#108696PurposeFor expression in E. coli, and affinity purification of N-terminally GST-tagged Archaeoglobus fulgidus RNase HII with C-terminal PIP box deletionDepositorInsertrnhB
TagsGSTExpressionBacterialMutationC-terminal truncation (7aa) removing PIP boxPromotertacAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
mTFP1-Tubulin-6
Plasmid#55512PurposeLocalization: Microtubules, Excitation: 462, Emission: 492DepositorAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN(E12,14K)-mPAGFP
Plasmid#168495PurposeMammalian expression of the E12,14K mutant of the N-terminal 47 residues of mouse PKA Catalytic subunit α C-terminally tagged by monomeric paGFP.DepositorInsertE12,14K mutant of the N-terminal 47 residues of mouse PKA Catalytic subunit α C-terminally tagged by monomeric paGFP
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
MS2-adRNA (3'UAG)
Plasmid#170128PurposeLentiviral vector carrying 2 copies of the MS2 adRNA targeting a UAG at the 3' end of the ADAR2 deaminase domain in plasmids #170124 and 170125DepositorInsertMS2-ADAR2(3'UAG)-MS2
UseLentiviralExpressionMammalianPromoterHuman U6 and mouse U6Available SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
LjUBQ:MtGLV6:T35s
Plasmid#164741PurposeOverexpression of Peptide coding gene (Binary vector)DepositorInsertMedtr3g095180.1
TagsTerminator 35SExpressionPlantPromoterLotus japonicus UbiquitinAvailable SinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
LjUBQ:MtGLV2:T35s
Plasmid#164740PurposeOverexpression of Peptide coding gene (Binary vector)DepositorInsertMedtr5g012400.1
TagsTerminator 35SExpressionPlantPromoterLotus japonicus UbiquitinAvailable SinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
px330-UFSP2 sgRNA1
Plasmid#134638Purposecontains sgRNA targeting human UFSP2 for gene knockoutDepositorInsertUFSP2 sgRNA1 (UFSP2 Human)
ExpressionMammalianAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
mTFP1-Rab4a-7
Plasmid#55507PurposeLocalization: Ras GTPase, Excitation: 462, Emission: 492DepositorAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER20-Flag-NLS-hSPDEF delta1
Plasmid#100874PurposeLentiviral expression of human SPDEF truncationDepositorInsertSPDEF (SPDEF Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationtruncated protein 1-248aaPromoterTRE2Available SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTRE/SP N184X with 5'UTR
Plasmid#92375PurposeInducible expression of N184X spastin M1 and M87 in mammalian cellsDepositorAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
mTFP1-H4-23
Plasmid#55491PurposeLocalization: Nucleus/Histones, Excitation: 462, Emission: 492DepositorAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
mTFP1-Alpha-Actinin-19
Plasmid#55464DepositorAvailable SinceOct. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
TtEnd_CDC_pEHISTEV
Plasmid#179736PurposeTtEnd_CDC_pEHISTEV expresses tuncated variant of TtEnd5A (186-531 amni caids) comprsisng of cataytic domain and a linker at C-terminal.DepositorInsertTtEnd5A
Tags6xHisExpressionBacterialMutation185 Amino acids from N-terminal were deleted.PromoterT7Available SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
TtEnd_CDN_pEHISTEV
Plasmid#179738PurposeTtEnd_CDN_pEHISTEV expresses tuncated variant of TtEnd5A (19-486 amnino acids) comprsisng of cataytic domain and a linker at N-terminal.DepositorInsertTtEnd5A
Tags6xHisExpressionBacterialMutation45 Amino acids from C-terminal were deleted.PromoterT7Available SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSilencer2.1-U6-NL8F50
Plasmid#190850PurposeFor mammalian expression of NL8F50, a dual-specificity aptamer that binds OGT and β-catenin. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a flexible linker.DepositorInsertNL8F50 (A Dual-Specificity aptamer targeting OGT and β-catenin)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSilencer2.1-U6-NL8F70
Plasmid#190851PurposeFor mammalian expression of NL8F70, a dual-specificity aptamer that binds OGT and β-catenin. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a flexible linker.DepositorInsertNL8F70 (A Dual-Specificity aptamer targeting OGT and β-catenin)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSilencer2.1-U6-3JB8F+4
Plasmid#190853PurposeFor mammalian expression of 3JB8F+4, a dual-specificity aptamer that binds OGT and β-catenin. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a folded linker.DepositorInsert3JB8F_T1+4bp (A Dual-Specificity aptamer targeting OGT and β-catenin)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSilencer2.1-U6-3JB8R+12
Plasmid#190855PurposeFor mammalian expression of 3JB8R+12, a dual-specificity aptamer that binds OGT and β-catenin. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a folded linker.DepositorInsert3JB8R_bc339+12bp (A Dual-Specificity aptamer targeting OGT and β-catenin)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
H1.224.luc
Plasmid#193704PurposeExpresses a truncated PolII H1 promoter (H1.244)DepositorInsertTruncated PolIII H1 promoter of 224 nucleotides (H1.224) + N41 fragment
UseLuciferaseExpressionMammalianAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN (E12,14A)-mVenus
Plasmid#168499PurposeMammalian expression of the E12,14A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus.DepositorInsertthe E12,14A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN (K8,9R)-mVenus
Plasmid#168498PurposeMammalian expression of the K8,9R mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus.DepositorInsertthe K8,9R mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN(K8,9A)-mPAGFP
Plasmid#168494PurposeMammalian expression of the K8,9A mutant of the N-terminal 47 residues of mouse PKA Catalytic subunit α C-terminally tagged by monomeric paGFP.DepositorInsertK8,9A mutant of the N-terminal 47 residues of mouse PKA Catalytic subunit α C-terminally tagged by monomeric paGFP.
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN (E12,14K)-mVenus
Plasmid#168488PurposeMammalian expression of the E12,14K mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus.DepositorInsertthe E12,14K mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN (K8,9E)-mVenus
Plasmid#168487PurposeMammalian expression of the E12,14A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus.DepositorInsertthe E12,14A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN (K22,24A)-mVenus
Plasmid#168484PurposeMammalian expression of the K22,24A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus.DepositorInsertthe K22,24A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN (K8,9A)-mVenus
Plasmid#168483PurposeMammalian expression of the K8,9A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus.DepositorInsertthe K8,9A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN (G2A)-mVenus
Plasmid#168482PurposeMammalian expression of the G2A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus.DepositorInsertthe G2A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
sg2+sg3
Plasmid#113970PurposeDouble short guide RNA targeting TACCACATTTGTAGAGGTT & CAATGTATCTTATCATGTCDepositorInsertsg2+sg3
ExpressionMammalianPromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only