We narrowed to 105,325 results for: lias
-
Plasmid#19136DepositorAvailable SinceSept. 8, 2008AvailabilityAcademic Institutions and Nonprofits only
-
GST-TEVcs-ATG101
Plasmid#171414PurposeFor the purifcation of human ULK1 complexDepositorInsertATG101 (ATG101 Synthetic)
ExpressionMammalianAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf221
Plasmid#12909PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf221
ExpressionMammalianAvailable SinceDec. 29, 2006AvailabilityAcademic Institutions and Nonprofits only -
MTK0_012
Plasmid#123967PurposeEncodes the hROSA26 BxBI recognition site with Hygromycin resistance and mRuby2 landing pad with GFP dropout destination vector as a type 0 part to be used in the MTK systemDepositorInserthRosa26-BxBI landing pad
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
LITE1.0_pAAV_hSyn_CRY2PHR-NLS-VP64_2A_GFP_WPRE_bGHpA
Plasmid#48253PurposeLITE1.0 CRY2PHR fused to VP64 transcriptional activator domain. Binds to CIB1 upon blue light stimulation. Synapsin promoter for neuronal expression. See LITE2.0 for optimized LITE activators.DepositorInsertCRY2PHR-NLS-VP64
UseAAV; TaleTags2A_GFPExpressionMammalianPromoterEF1-alphaAvailable SinceOct. 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-fTCAP-GFP
Plasmid#22916DepositorInsertfugu titan cap promoter driving GFP
UseAAVExpressionMammalianAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
BC1455-LMNA 5'HA-mCherry-CRISPR-Tag_V2-3'HA (HDR donor)
Plasmid#164042PurposeCRISPR donor plasmid to insert mCherry-harboring CRISPR-TagV2 into the N-terminus of human LMNA geneDepositorInsertmCherry-CRISPR-TagV2
UseCRISPRExpressionMammalianAvailable SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJZC40
Plasmid#62334PurposesgRNA + 2x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 2x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
p15a_Kan_MLS_Rosa26_Short_CRISPRDel_CAG_RNeoStop_WPRE_bgh_pA
Plasmid#97011PurposeRosa26 targeting vector for Dre-responsive cassetteDepositorTypeEmpty backboneUseCRISPR and Cre/LoxExpressionMammalianAvailable SinceMarch 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
GST-TEVcs-GFP-ATG101
Plasmid#171415PurposeFor the purifcation of GFP-ULK1 complexDepositorInsertATG101 (ATG101 Synthetic)
ExpressionMammalianAvailable SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPAtUbq10 (GB0223)
Plasmid#68174PurposeProvides the Arabidopsis thaliana polyubiquitin 10 promoter as a level 0 GoldenBraid partDepositorInsertAtUbq10 promoter
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_m4_KRAB_EBFP2
Plasmid#167873PurposePiggyBac compatible plasmid expressing dCas9-KRABDepositorInsertdCas9-KRAB
UseCRISPRMutationD10A, D839A, H840A, N863AAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
GST-GFP-ATG14
Plasmid#171426PurposeFor the purifcation of GFP- PI3KC3 complexDepositorInsertATG14 (ATG14 Human)
ExpressionMammalianAvailable SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCSDest2-SpCas9-WT-NLS-3XHA-NLS-ZFP_TS3
Plasmid#69226PurposeExpresses wild type SpCas9 fused to ZFP-TS3 in mammalian cellsDepositorInsertTS3 ZFP
UseCRISPRTagsNLS-3XHA-NLSExpressionMammalianAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
SauCas9KKH CCR5-nicking sgRNA
Plasmid#169863PurposeSauCas9KKH nicking sgRNA for CCR5DepositorInsertSauCas9KKH CCR5-nicking sgRNA
ExpressionMammalianPromoterhuman U6 promoterAvailable SinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
JPF0522
Plasmid#124013PurposeEncodes crippled pEF1a driving expression of mAzamiGreen with an mScarlet normalization in a PiggyBac destination vectorDepositorInsertPB_pEF1ac-NLS-mAzamiGreen-bghpA_pCAG-H2B::mScarlet-rglpA
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
mGFAP R236H
Plasmid#169475PurposeSingle p.Arg236His(R236H) mutation was individually inserted by site-directed mutagenesis into the wild-type mGFAPDepositorInsertHaloTAG mGFAP (R236H) (Gfap Mouse)
TagsEGFPExpressionMammalianMutationChanged R 236 to HAvailable SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
JPF0454
Plasmid#124039PurposeEncodes pPGK1 driving expression of spCas9 P2A mAzamiGreen in a 2nd gen. Lenti Virus destination vectorDepositorInsertpHR_pPGK1-spCAS9-P2A-mAzamiGreen
ExpressionMammalianAvailable SinceFeb. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPAct2noUTR (GB0192)
Plasmid#68177PurposeProvides the Arabidopsis thaliana actin2 gene promoter (without 5' UTR) as a level 0 GoldenBraid partDepositorInsertAtAct2 promoter (no UTR)
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pW213-lenti-sasgRNA-Esp3I-2kb-filler-pEF1s-NLS-mNeonGreen-P2A-BlastR
Plasmid#170811PurposeLentiviral vector to co-express an sasgRNA with NLS-mNeonGreenDepositorTypeEmpty backboneUseLentiviralExpressionMammalianMutationNAAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKD011 CMV 3xFLAG-NLS-ZF2-ABI1 in TUPV2
Plasmid#161548PurposeConstitutive expression of 3xFLAG-NLS-ZF2-ABI1 under the CMV promoterDepositorInsert3xFLAG-NLS-ZF2-ABI1
UseSynthetic BiologyTags3x-FLAGExpressionMammalianPromoterCMVAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
fgfprom luc
Plasmid#69446Purposebasal plasmid containing minimal fgf4 promoter used for testing enhancer activity of DNAs inserted immediately upstream of the promoter.DepositorInsertminimal fgf4 promoter
UseLuciferaseExpressionMammalianAvailable SinceMay 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
MTK234_027
Plasmid#123907PurposeEncodes the spCas9 sgRNA1 hThal5.10-2_hg18 (site 1) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertsgRNA1 -hThal5.10-2_hg18
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MSCVpic2neo-EGFP-FF2
Plasmid#164922PurposeExpresses EGFP cDNA and FF2 shRNA in mammalian cellsDepositorInsertsUseRetroviralAvailable SinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDF-NtXNtT5R1AtR2NtB2
Plasmid#160888PurposeExpression of N. tabacum Rubisco small subunit (rbcS-T5), Rubisco chaperone protiens rbcX, raf1, bsd2 and A. thaliana Rubisco chaperone proteins raf2 in E. coli.DepositorInsertPT7-Nt-rbcS-T5
ExpressionBacterialPromoterrbcS-T5: T7, chaperones: T11Available SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDF-NtXNtT1R1AtR2NtB2
Plasmid#160885PurposeExpression of N. tabacum Rubisco small subunit (rbcS-T1), Rubisco chaperone protiens rbcX, raf1, bsd2 and A. thaliana Rubisco chaperone proteins raf2 in E. coli.DepositorInsertPT7-Nt-rbcS-T1
ExpressionBacterialPromoterrbcS-T1: T7, chaperones: T8Available SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDF-NtXNtS5R1AtR2NtB2
Plasmid#160884PurposeExpression of N. tabacum Rubisco small subunit (rbcS-S5), Rubisco chaperone protiens rbcX, raf1, bsd2 and A. thaliana Rubisco chaperone proteins raf2 in E. coli.DepositorInsertPT7-Nt-rbcS-S5
ExpressionBacterialPromoterrbcS-S5: T7, chaperones: T7Available SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDF-NtXNtS2R1AtR2NtB2
Plasmid#160883PurposeExpression of N. tabacum Rubisco small subunit (rbcS-S2), Rubisco chaperone protiens rbcX, raf1, bsd2 and A. thaliana Rubisco chaperone proteins raf2 in E. coli.DepositorInsertrbcS-S2, rbcX, raf1, raf2, bsd2
ExpressionBacterialPromoterrbcS-S2: T7, chaperones: T7Available SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJM582 EF1α 3xFLAG-NLS-VP64-ZF2 in TUPV2
Plasmid#161543PurposeConstitutive expression of 3xFLAG-NLS-VP64-ZF2 under the EF1α promoterDepositorInsert3xFLAG-NLS-VP64-ZF2
UseSynthetic BiologyTags3x-FLAGExpressionMammalianPromoterEF1αAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only