334,597 results
-
Plasmid#214347PurposeExpresses pIIIDepositorInsertgIII-xLuxAB
ExpressionBacterialAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
mU6-CR1-CRISPRiv2_hU6-CR3-NT-ctrl-guide_EF1a-PuroR-T2A-BFP
Pooled Library#197348PurposeTo allow for genome-wide genetic modifier screening, the library has a second fixed non-targeting control guide.DepositorSpeciesHomo sapiensUseLentiviralAvailable SinceMay 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-DLL4-COMP5AP-AviTag-9xHis
Plasmid#157453PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-DLL4-COMP5AP-AviTag-9xHis
Plasmid#157453PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-hM3D(Gq)-mCherry-WPRE-pA(Short)
Plasmid#183705PurposeAAV to express hM3D(Gq)-mCherry fusion protein. Viral genome 3' UTR modified to bring the viral genome below the optimal AAV packaging limitDepositorInserthM3D(Gq)
UseAAVTagsmCherryPromoterCaMKIIaAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-hM3D(Gq)-mCherry-WPRE-pA(Short)
Plasmid#183705PurposeAAV to express hM3D(Gq)-mCherry fusion protein. Viral genome 3' UTR modified to bring the viral genome below the optimal AAV packaging limitDepositorInserthM3D(Gq)
UseAAVTagsmCherryPromoterCaMKIIaAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVTFrep4-creb
Plasmid#182057PurposePlasmids for production of LV-based TFactivity reporterDepositorInsertRep4 and Ref4
UseLentiviralPromotersynthetic minimal promoterAvailable SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVTFrep4-creb
Plasmid#182057PurposePlasmids for production of LV-based TFactivity reporterDepositorInsertRep4 and Ref4
UseLentiviralPromotersynthetic minimal promoterAvailable SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
FR_GFP
Plasmid#31302DepositorInsertgreen fluorescent protein
ExpressionMammalianAvailable SinceOct. 28, 2011AvailabilityAcademic Institutions and Nonprofits only -
FR_GFP
Plasmid#31302DepositorInsertgreen fluorescent protein
ExpressionMammalianAvailable SinceOct. 28, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-tdTomato
Plasmid#28306DepositorHas ServiceAAV PHP.S, AAV PHP.eB, AAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InserttdTomato
UseAAV and Cre/Lox; Adeno-associated virusExpressionMammalianMutationN/APromoterCAGAvailable SinceSept. 7, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-tdTomato
Plasmid#28306DepositorHas ServiceAAV PHP.S, AAV PHP.eB, AAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InserttdTomato
UseAAV and Cre/Lox; Adeno-associated virusExpressionMammalianMutationN/APromoterCAGAvailable SinceSept. 7, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.Flex.GCaMP6f.WPRE.SV40 (AAV9)
Viral Prep#100835-AAV9PurposeReady-to-use AAV9 particles produced from pAAV.CAG.Flex.GCaMP6f.WPRE.SV40 (#100835). In addition to the viral particles, you will also receive purified pAAV.CAG.Flex.GCaMP6f.WPRE.SV40 plasmid DNA. CAG-driven, Cre-dependent GCaMP6f calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.Flex.GCaMP6f.WPRE.SV40 (AAV9)
Viral Prep#100835-AAV9PurposeReady-to-use AAV9 particles produced from pAAV.CAG.Flex.GCaMP6f.WPRE.SV40 (#100835). In addition to the viral particles, you will also receive purified pAAV.CAG.Flex.GCaMP6f.WPRE.SV40 plasmid DNA. CAG-driven, Cre-dependent GCaMP6f calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPB_mU6_enh-gRNA_Puro-T2A-BFP
Plasmid#235571PurposeEnhanced guide RNA expression & genomic integration. Target gRNA sequences are cloned in via the BstXI and BlpI sites.DepositorInsertsgRNA backbone
UseCRISPRAvailable SinceApril 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB_mU6_enh-gRNA_Puro-T2A-BFP
Plasmid#235571PurposeEnhanced guide RNA expression & genomic integration. Target gRNA sequences are cloned in via the BstXI and BlpI sites.DepositorInsertsgRNA backbone
UseCRISPRAvailable SinceApril 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmScarlet3-LaminB_C1
Plasmid#189776PurposeConstruct for labelling nuclear envelopes in mammaiian cells using mScarlet3-LaminB fusionDepositorInsertmScarlet3-LaminB
ExpressionMammalianPromoterCMVAvailable SinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pmScarlet3-LaminB_C1
Plasmid#189776PurposeConstruct for labelling nuclear envelopes in mammaiian cells using mScarlet3-LaminB fusionDepositorInsertmScarlet3-LaminB
ExpressionMammalianPromoterCMVAvailable SinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits only